Turkish Journal of Agriculture and Forestry Turkish Journal of Agriculture and Forestry Volume 49 Number 1 Article 8 2-11-2025 Molecular screening of septoria-resistant genes in historical Molecular screening of septoria-resistant genes in historical Turkish bread wheat germplasm using the validated gene specific Turkish bread wheat germplasm using the validated gene specific SSR markers SSR markers AMJAD ALI FATİH ÖLMEZ MUHAMMED TATAR PARNAZ MORTAZAVI MUHAMMAD TANVEER ALTAF See next page for additional authors Follow this and additional works at: https://journals.tubitak.gov.tr/agriculture Part of the Agriculture Commons, and the Forest Sciences Commons Recommended Citation Recommended Citation ALI, AMJAD; ÖLMEZ, FATİH; TATAR, MUHAMMED; MORTAZAVI, PARNAZ; ALTAF, MUHAMMAD TANVEER; TURGAY, EMİNE BURCU; AKTAŞ, HÜSNÜ; NADEEM, MUHAMMAD AZHAR; JAVED, JAZIB; GOU, JIN-YING; AASIM, MUHAMMAD; DABABAT, ABDELFATTAH A.; and BALOCH, FAHEEM SHEHZAD (2025) "Molecular screening of septoria-resistant genes in historical Turkish bread wheat germplasm using the validated gene specific SSR markers," Turkish Journal of Agriculture and Forestry: Vol. 49: No. 1, Article 8. https://doi.org/10.55730/1300-011X.3251 Available at: https://journals.tubitak.gov.tr/agriculture/vol49/iss1/8 This work is licensed under a Creative Commons Attribution 4.0 International License. This Research Article is brought to you for free and open access by TÜBİTAK Academic Journals. It has been accepted for inclusion in Turkish Journal of Agriculture and Forestry by an authorized editor of TÜBİTAK Academic Journals. For more information, please contact academic.publications@tubitak.gov.tr https://journals.tubitak.gov.tr/ https://journals.tubitak.gov.tr/ https://journals.tubitak.gov.tr/agriculture https://journals.tubitak.gov.tr/agriculture/vol49 https://journals.tubitak.gov.tr/agriculture/vol49/iss1 https://journals.tubitak.gov.tr/agriculture/vol49/iss1/8 https://journals.tubitak.gov.tr/agriculture?utm_source=journals.tubitak.gov.tr%2Fagriculture%2Fvol49%2Fiss1%2F8&utm_medium=PDF&utm_campaign=PDFCoverPages https://network.bepress.com/hgg/discipline/1076?utm_source=journals.tubitak.gov.tr%2Fagriculture%2Fvol49%2Fiss1%2F8&utm_medium=PDF&utm_campaign=PDFCoverPages https://network.bepress.com/hgg/discipline/90?utm_source=journals.tubitak.gov.tr%2Fagriculture%2Fvol49%2Fiss1%2F8&utm_medium=PDF&utm_campaign=PDFCoverPages https://doi.org/10.55730/1300-011X.3251 https://journals.tubitak.gov.tr/agriculture/vol49/iss1/8?utm_source=journals.tubitak.gov.tr%2Fagriculture%2Fvol49%2Fiss1%2F8&utm_medium=PDF&utm_campaign=PDFCoverPages https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ mailto:academic.publications@tubitak.gov.tr Molecular screening of septoria-resistant genes in historical Turkish bread wheat Molecular screening of septoria-resistant genes in historical Turkish bread wheat germplasm using the validated gene specific SSR markers germplasm using the validated gene specific SSR markers Authors Authors AMJAD ALI, FATİH ÖLMEZ, MUHAMMED TATAR, PARNAZ MORTAZAVI, MUHAMMAD TANVEER ALTAF, EMİNE BURCU TURGAY, HÜSNÜ AKTAŞ, MUHAMMAD AZHAR NADEEM, JAZIB JAVED, JIN-YING GOU, MUHAMMAD AASIM, ABDELFATTAH A. DABABAT, and FAHEEM SHEHZAD BALOCH This research article is available in Turkish Journal of Agriculture and Forestry: https://journals.tubitak.gov.tr/ agriculture/vol49/iss1/8 https://journals.tubitak.gov.tr/agriculture/vol49/iss1/8 https://journals.tubitak.gov.tr/agriculture/vol49/iss1/8 89 http://journals.tubitak.gov.tr/agriculture/ Turkish Journal of Agriculture and Forestry Turk J Agric For (2025) 49: 89-109 © TÜBİTAK doi:10.55730/1300-011X.3251 Molecular screening of septoria-resistant genes in historical Turkish bread wheat germplasm using the validated gene specific SSR markers Amjad ALI1 , Fatih ÖLMEZ1 , Muhammed TATAR1 , Parnaz MORTAZAVI2 , Muhammad Tanveer ALTAF3 , Emine Burcu TURGAY4 , Hüsnü AKTAŞ5 , Muhammad Azhar NADEEM2 , Jazib JAVED6 , Jin-Ying GOU6 , Muhammad AASIM1 , Abdelfattah A. DABABAT7 , Faheem Shehzad BALOCH8,9,*  1Department of Plant Protection, Faculty of Agricultural Sciences and Technology, Sivas University of Science and Technology, Sivas, Turkiye 2Department of Plant Production and Technologies, Faculty of Agricultural Sciences and Technology, Sivas University of Science and Technology, Sivas, Turkiye 3Department of Field Crops, Faculty of Agriculture, Recep Tayyip Erdoğan University, Rize, Turkiye 4Field Crops Central Research Institute, Ankara, Turkiye 5Kızıltepe Agriculture Science and Technology Faculty, Mardin Artuklu University, Mardin, Turkiye 6Frontiers Science Center for Molecular Design Breeding, China Agricultural University, Beijing, China 7International Maize and Wheat Improvement Centre (CIMMYT), Ankara, Turkiye 8Dapartment of Biotechnology, Faculty of Science, Mersin University, Mersin, Turkiye 9Department of Plant Resources and Environment, Jeju National University, Republic of Korea * Correspondence: balochfaheem13@gmail.com 1. Introduction Wheat belongs to the family Poaceae, and is the second most widely cultivated cereal crop worldwide, after rice. The wheat production industry continues to expand, contributing significantly to global food security by providing 20% of the world’s total food supply (Khalid et al., 2023; Altaf et al., 2024a). Archaeological evidence suggests that wheat originated in the Fertile Crescent, which includes modern-day Türkiye, Iran, Lebanon, Palestine, Iraq, Syria, and Jordan. Türkiye is particularly recognized as the key source of genetic diversity for wild wheat species and the birthplace of wheat cultivation, with evidence of Einkorn wheat (siyez wheat) domestication in southeastern Türkiye dating back to approximately 9000 BC (Cooper, 2015; Atak, 2017; Altaf et al., 2024b). From Anatolia, these wild ancestors spread worldwide, leading to diverse culture manifestations (Karagöz, 2019). Recent data shows that global wheat production has reached 761 million metric tons, with Türkiye contributing 20.5 million metric tons. Notably, bread wheat (T. aestivum) constitutes approximately 95% of the global production, with the remaining 5% from durum wheat (Özkan and Hülya, 2024). Abstract: Septoria tritici blotch (STB), caused by Zymoseptoria tritici, poses a significant threat to global wheat production, particularly in Türkiye. Resistance breeding is the most sustainable and effective disease control method. Molecular markers, especially simple sequence repeat (SSR) markers are extensively employed in wheat breeding to enhance the efficacy. The primary objective of this study was to identify Stb resistance genes among 143 historical registered Turkish bread wheat genotypes released as commercial cultivars between 1963 to 2014, using 16 closely linked SSR markers. The findings revealed substantial genetic variation among the screened cultivars, with the Stb3 gene being the most prevalent, identified in 89.51% of the samples. Other notable resistant genes included Stb13 (71.32%), Stb4 (43.33%), and Stb11 (41.25%). Cultivars Porsuk-2811, Porsuk-2853, and Porsuk-2868 exhibited the highest level of resistance to STB, with 10 resistance genes detected. Of the 143 cultivars screened, 10 were found to carry a total of nine Stb genes, while two cultivars were observed to possess only a single resistance gene. The study identified 23 wheat cultivars harboring 8–10 Stb resistance genes, which are highly recommended for future wheat breeding programs and gene pyramiding strategies to combat Z. tritici. This research provides critical insights for national breeding programs, supporting the development of resilient and high-yielding wheat varieties resistant to STB. Key words: Resistance breeding, molecular marker, ICARDA and CIMMYT, fertile crescent, gene pyramiding Received: 04.07.2024 Accepted/Published Online: 26.11.2024 Final Version: 11.02.2025 Research Article This work is licensed under a Creative Commons Attribution 4.0 International License. https://orcid.org/0000-0003-0816-1872 https://orcid.org/0000-0001-7016-2708 https://orcid.org/0000-0002-8312-8434 https://orcid.org/0009-0008-2155-2492 https://orcid.org/0000-0003-2373-857X https://orcid.org/0000-0003-1150-4901 https://orcid.org/0000-0001-6943-2109 https://orcid.org/0000-0002-0637-9619 https://orcid.org/0000-0002-9812-4890 https://orcid.org/0000-0002-7540-0354 https://orcid.org/0000-0002-8524-9029 https://orcid.org/0000-0002-3172-0452 https://orcid.org/0000-0002-7470-0080 mailto:balochfaheem13@gmail.com ALI et al. / Turk J Agric For 90 Plant pathogens and pests are responsible for up to 40% of rice, maize, wheat, potato, and soybean crop yield losses worldwide. Plant diseases caused by fungi, bacteria, nematodes, virus, and virus-like organisms cost the global economy USD 220 billion annually (He and Krainer, 2020; Rehman et al., 2023; Ali et al., 2024; Kanwal et al., 2024; Naqvi et al., 2024). Among these, the fungal disease Septoria tritici blotch (STB), caused by Zymoseptoria tritici (formerly known as Mycosphaerella graminicola), has been identified as a key contributor to diminished wheat production globally, as well as in Türkiye (Ünal et al., 2017; Ölmez et al., 2023). STB induces irregular chlorotic patches on wheat leaves, that progress into necrotic lesions, impairing photosynthesis and leading to significant yield losses of 34% to 54% in affected regions (Brown et al., 2015). The pathogen persists in contaminated seeds, straw, and volunteer weeds, with environmental factors like high humidity, rain, and temperatures between 20 and 28 °C facilitating its spread (Ünal et al., 2017). While fungicides are commonly used, their effectiveness is undermined by the rapid development of resistant strains, resulting in economic loss, particularly in Europe (Torriani et al., 2009; Mahboubi et al., 2020). Therefore, developing resistant wheat cultivars is the most economically and ecologically viable strategy for STB control, with ongoing research expanding the gene pool used in breeding initiatives (Brown et al., 2015; Zenda et al., 2021). There are two types of resistance to STB in wheat plants. The first is qualitative, which is controlled by major qualitative genes following the gene-for-gene paradigm. The second is quantitative, which is a polygenic trait observed in both adult and seedling stages (Arraiano and Brown, 2006). The identification of the first Stb gene, Stb1, in winter wheat cultivar Bulgaria 88 in 1957 marked a significant milestone, leading to its use in commercial cultivars like Oasis and Sullivan (Narvaez and Caldwell, 1957; Goodwin, 2007; Tabib et al., 2011). To date, 21 Stb genes considered resistant to Z. tritici have been cataloged and mapped within the wheat genome (Yang et al., 2018; Hafeez et al., 2023). Wheat breeding in Türkiye began with the establishment of the first research center, Islah Buzur, in Eskisehir in 1925, coinciding with the foundation of the Republic of Türksiye (Özbek et al., 2024). This center was followed by additional stations in Adapazarı, Yeşilköy (İstanbul), and Ankara, all founded before 1930. By 1989, Türkiye had 14 public research institutes that focused on wheat research, with the first variety, Karakılçık1133, introduced in 1928 by the Yeşilköy Agricultural Research Station (Altay, 2018). In 1967, the national wheat breeding program was initiated through the National Wheat Release and Training Project, in collaboration with the International Center for Maize and Wheat Improvement (CIMMYT) and the International Center for Agricultural Research in the Dry Areas (ICARDA) (Aktaş and Baloch, 2017). To date, Türkiye has released 221 wheat varieties, with Italy, France, and Bulgaria being the top contributors. However, for the majority of bread wheat cultivars in Türkiye that are prone to susceptibility to STB, particularly in the Aegean and Mediterranean regions, heavy rainfall can reduce yields by 30% to 40% (Ünal et al., 2017). Z. tritici and Stagonospora nodorum are the main reasons behind the STB in wheat in these regions. The International Winter Wheat Improvement Program (IWWIP), established in 1986 in Türkiye, focuses on developing adaptable, disease-resistant, and high-quality wheat germplasm for central and western Asia. A collaboration between the Turkish Ministry of Food, Agriculture, and Livestock, ICARDA, IWWIP, and CIMMYT conducts breeding across multiple locations in Türkiye. Every year, IWWIP germplasm is distributed to collaborators worldwide for evaluation and selection, resulting in the introduction of over 65 cultivars in the region (Morgounov et al., 2016). DNA markers closely linked to particular genomic regions of pivotal agricultural plants are crucial for regulating important traits and serve as distinct reference points for monitoring target integration in breeding materials. Among these, simple sequence repeats (SSR)/ microsatellite, and single nucleotide polymorphisms (SNP) are the most widely used in genome-assisted resistance breeding initiatives (Simón et al., 2012; Sinha et al., 2023; Altaf et al., 2024c; Yalinkiliç et al., 2024). Notably, Stb resistance genes in wheat are closely linked to multiple SSR markers, with around 21 resistance genes (e.g., Stb1- 18, StbSm3, StbWW, and TmStb1) and their associated markers identified (Adhikari et al., 2003; Adhikari et al., 2004a, 2004b; Arraiano et al., 2001; Brading et al., 2002; McCartney et al., 2003; Chartrain et al., 2005a, 2005b; Jing et al., 2008; Chartrain et al., 2009; Raman et al., 2009; Tabib et al., 2012). However, there is a significant lack of modern molecular tools to evaluate and incorporate resistance genes into susceptible, high-yielding cultivars, as well as develop new varieties with long-lasting resilience. The current research focused on utilizing 16 closely linked SSR markers to screen for Stb resistance genes in 143 registered Turkish bread wheat genotypes released as commercial cultivars from various agricultural research institutes in Türkiye. This study aimed to highlight these resistance genes and cultivars for further gene pyramiding, thereby initiating genome-assisted resistance breeding efforts in Türkiye. This understanding holds significant importance for wheat breeders in developing high-yielding, STB-resistant cultivars by incorporating resistance genes derived from these officially released Turkish bread wheat cultivars into new varieties. ALI et al. / Turk J Agric For 91 2. Material and methods 2.1. Plant material During the present investigation, 143 bread wheat genotypes released as commercial cultivars from various agricultural research institutes in Türkiye were used as plant material. These cultivars were not randomly collected but were officially released by well-known agricultural research institutes across Türkiye (Table 1). Specifically, 31 cultivars were obtained from the Aegean Agricultural Research Institute (ATAEM) in Eskişehir, 21 from the Central Research Institute for Field Crops (TARM) in Ankara, 15 from the East Mediterranean Agricultural Research Institute (DATAEM) in Adana, 13 from the Aegean Agricultural Research Institute (ETAEM) in İzmir, and 13 from the Trakya Agricultural Research Institute (TTAEM) in Edirne. Additionally, 10 cultivars were provided by the Eastern Anatolia Agricultural Research Institute (STAEM) in Erzurum and the Southeast Anatolia Agricultural Research Institute (DATAE) in Şanlıurfa, nine from the Bahri Dağdaş International Agricultural Research Institute (BDUAAEM) in Konya, five from both the Southeastern Anatolia Project Agricultural Research Institute (GATAEM) in Diyarbakır and the Black Sea Agricultural Research Institute (KATAE) in Samsun, four from the Faculty of Agriculture at Ankara University, three from Çukurova University in Adana, two from Tasaco Tarım A.Ş. (TASACO) in İstanbul, and one each from Uludağ University in Bursa and GAP Agricultural Research Institute (GAP-EYAM) in Şanlıurfa. Serial No. Genotypes Collection locations Wheat type Date of Registration Grain color Presence of Awn 1 Ankara 093/44 TARM/ANK T. aestivum 7.10.1963 White Yes 2 Köse 220/39 TARM/ANK T. aestivum 7.10.1963 White No 3 Sivas 111/33 TARM/ANK T. aestivum 7.10.1963  - Yes 4 Sürak M. 1593/51 TARM/ANK T. aestivum 7.10.1963  - Yes 5 Haymana 79 TARM/ANK T. aestivum 15.05.1979 Red Yes 6 Gün-91 TARM/ANK T. aestivum 26.04.1991 Red Yes 7 İkizce 96 TARM/ANK T. aestivum 16.04.1996 Red Yes 8 Mızrak TARM/ANK T. aestivum 12.05.1998 White Yes 9 Türkmen TARM/ANK T. aestivum 12.05.1998 White Yes 10 Uzunyayla TARM/ANK T. aestivum 12.05.1998 White Yes 11 Yakar-99 TARM/ANK T. aestivum 26.04.1999 White Yes 12 Aksel 2000 TARM/ANK T. aestivum 28.04.2000 Red Yes 13 Bayraktar 2000 TARM/ANK T. aestivum 28.04.2000 White Yes 14 Demir 2000 TARM/ANK T. aestivum 28.04.2000 Red Yes 15 Atlı-2002 TARM/ANK T. aestivum 2.05.2002 Red Yes 16 Zencirci-2002 TARM/ANK T. aestivum 2.05.2002 White Yes 17 Eser TARM/ANK T. aestivum 2.05.2003 White Yes 18 Seval TARM/ANK T. aestivum 1.04.2004 Red Yes 19 Tosunbey TARM/ANK T. aestivum 1.04.2004 White Yes 20 Kenanbey TARM/ANK T. aestivum 6.04.2009 White Yes 21 Lütfibey TARM/ANK T. aestivum 30.03.2010 Red Yes 22 4-11 ATAEM/ESK T. aestivum 7.10.1963  - No 23 4-22 ATAEM/ESK T. aestivum 7.10.1963  - No 24 P 8-6 ATAEM/ESK T. aestivum 7.10.1963  - Yes Table 1. Catalogue of historical registered Turkish bread wheat cultivars: origins, historical records, and information about other valuable characteristics (1963–2014). ALI et al. / Turk J Agric For 92 Table 1. (Continued.) 25 P 8-8 ATAEM/ESK T. aestivum 7.10.1963  - No 26 Melez ATAEM/ESK T. aestivum 11.04.2014  - No 27 Ak 702 ATAEM/ESK T. aestivum 12.04.2014  - Yes 28 Sertak ATAEM/ESK T. aestivum 13.04.2014  - Yes 29 Yayla 305 ATAEM/ESK T. aestivum 9.04.1966  - Yes 30 Yektay 406 ATAEM/ESK T. aestivum 18.03.1968 Red Yes 31 Bolal 2973 ATAEM/ESK T. aestivum 27.04.1970 Red Yes 32 Kıraç 66 ATAEM/ESK T. aestivum 27.04.1970 White Yes 33 Porsuk-2800 ATAEM/ESK T. aestivum 13.05.1976 White Yes 34 Gerek 79 ATAEM/ESK T. aestivum 15.05.1979 White Yes 35 Atay-85 ATAEM/ESK T. aestivum 25.04.1985 White Yes 36 Kutluk 94 ATAEM/ESK T. aestivum 17.05.1994 White Yes 37 Kırgız 95 ATAEM/ESK T. aestivum 20.04.1995 White Yes 38 Sultan 95 ATAEM/ESK T. aestivum 20.04.1995 White Yes 39 Süzen 97 ATAEM/ESK T. aestivum 6.05.1997 White Yes 40 Aytın 98 ATAEM/ESK T. aestivum 12.05.1998 White Yes 41 Yıldız 98 ATAEM/ESK T. aestivum 12.05.1998 White Yes 42 Harmankaya-99 ATAEM/ESK T. aestivum 26.04.1999 Red Yes 43 Altay 2000 ATAEM/ESK T. aestivum 28.04.2000 White Yes 44 Çetinel 2000 ATAEM/ESK T. aestivum 28.04.2000 White Yes 45 Alpu 2001 ATAEM/ESK T. aestivum 24.04.2001 White Yes 46 İzgi 2001 ATAEM/ESK T. aestivum 24.04.2001 White Yes 47 Sönmez 2001 ATAEM/ESK T. aestivum 24.04.2001 Red No 48 Soyer02 ATAEM/ESK T. aestivum 2.05.2002 White Yes 49 Müfitbey ATAEM/ESK T. aestivum 14.04.2006 White Yes 50 Nacibey ATAEM/ESK T. aestivum 2.04.2008 Red Yes 51 ES 26 ATAEM/ESK T. aestivum 30.03.2010 White Yes 52 Yunus ATAEM/ESK T. aestivum 17.04.2012 Red No 53 Mesut ATAEM/ESK T. aestivum 12.04.2013  -  Yes 54 Dağdaş 94 BDUAAEM/KNY T. aestivum 17.05.1994 White Yes 55 Kınacı-97 BDUAAEM/KNY T. aestivum 6.05.1997 Red Yes 56 Göksu-99 BDUAAEM/KNY T. aestivum 26.04.1999 White Yes 57 Karahan-99 BDUAAEM/KNY T. aestivum 26.04.1999 White Yes 58 Bağcı-2002 BDUAAEM/KNY T. aestivum 2.05.2002 Red Yes 59 Konya-2002 BDUAAEM/KNY T. aestivum 2.05.2002 Red Yes 60 Ahmetağa BDUAAEM/KNY T. aestivum 1.04.2004 Red Yes 61 Ekiz BDUAAEM/KNY T. aestivum 1.04.2004 Red Yes 62 Eraybey BDUAAEM/KNY T. aestivum 17.04.2012 Red Yes 63 Kırkpınar 79 TTAEM/EDN T. aestivum 15.05.1979 White Yes ALI et al. / Turk J Agric For 93 Table 1. (Continued.) 64 Murat-1 TTAEM/EDN T. aestivum 26.04.1991  - Yes 65 Kate A-1 TTAEM/EDN T. aestivum 26.04.1988 Red No 66 Pehlivan TTAEM/EDN T. aestivum 12.05.1998 Red No 67 Prostor TTAEM/EDN T. aestivum 26.04.1999 Red Yes 68 Saroz 95 TTAEM/EDN T. aestivum 26.04.1999 White Yes 69 Atilla-12 TTAEM/EDN T. aestivum 24.04.2001 Red No 70 Saraybosna TTAEM/EDN T. aestivum 24.04.2001 Red No 71 Gelibolu TTAEM/EDN T. aestivum 30.03.2005 Red Yes 72 Tekirdağ TTAEM/EDN T. aestivum 30.03.2005 Red Yes 73 Aldane TTAEM/EDN T. aestivum 6.04.2009 Red No 74 Selimiye TTAEM/EDN T. aestivum 6.04.2009 Red No 75 Bereket TTAEM/EDN T. aestivum 30.03.2010 Red No 76 Saban TTAEM/EDN T. aestivum 11.04.2014 Red Yes 77 Lancer DATAE/ERZ T. aestivum 12.05.1977 Red Yes 78 Doğu 88 DATAE/ERZ T. aestivum 16.04.1990 Red Yes 79 Karasu 90 DATAE/ERZ T. aestivum 16.04.1990 Red No 80 Palandöken 97 DATAE/ERZ T. aestivum 6.05.1997 White Yes 81 Alparslan DATAE/ERZ T. aestivum 24.04.2001 Red Yes 82 Nenehatun DATAE/ERZ T. aestivum 24.04.2001 White Yes 83 Daphan DATAE/ERZ T. aestivum 2.05.2002 White Yes 84 Yıldırım DATAE/ERZ T. aestivum 2.05.2002 White Yes 85 Ayyıldız DATAE/ERZ T. aestivum 8.04.2011 Red Yes 86 Kırik DATAE/ERZ T. aestivum 30.03.2010  - Yes 87 Karacadağ 98 GATAEM/DYB T. aestivum 12.05.1998 Red Yes 88 Nurkent GATAEM/DYB T. aestivum 24.04.2001 White Yes 89 Cemre GATAEM/DYB T. aestivum 2.04.2008 White Yes 90 Dinç GATAEM/DYB T. aestivum 12.04.2013 White Yes 91 Tekin GATAEM/DYB T. aestivum 11.04.2014 White  Yes 92 İnia 66 STAEM/SKY T. aestivum 11.04.2014  - Yes 93 Bezostaja-1 STAEM/SKY T. aestivum 19.03.1968 Red No 94 Bandırma 97 STAEM/SKY T. aestivum 6.05.1997 White Yes 95 Karacabey 97 STAEM/SKY T. aestivum 6.05.1997 Red Yes 96 Pamukova 97 STAEM/SKY T. aestivum 6.05.1997 Red Yes 97 Momtchill STAEM/SKY T. aestivum 28.04.2000 Red No 98 Tahirova 2000 STAEM/SKY T. aestivum 28.04.2000 White Yes 99 Beşköprü STAEM/SKY T. aestivum 5.04.2007 Red Yes 100 Hanlı STAEM/SKY T. aestivum 5.04.2007 Red Yes 101 Metin STAEM/SKY T. aestivum 11.04.2014 Red   102 Sakin KATAE/SMN T. aestivum 2.05.2002 Red Yes ALI et al. / Turk J Agric For 94 103 Canik 2003 KATAE/SMN T. aestivum 2.05.2003 Red Yes 104 Özcan KATAE/SMN T. aestivum 1.04.2004 Red Yes 105 Nevzatbey KATAE/SMN T. aestivum 11.04.2014  -  Yes 106 Altındane KATAE/SMN T. aestivum 17.04.2012 White Yes 107 Cumhuriyet 75 ETAEM/İZM T. aestivum 13.05.1976 White Yes 108 Ata-81 ETAEM/İZM T. aestivum 25.04.1985 White Yes 109 İzmir 85 ETAEM/İZM T. aestivum 15.10.1985 White Yes 110 Marmara 86 ETAEM/İZM T. aestivum 30.04.1986 Red Yes 111 Kaklıç 88 ETAEM/İZM T. aestivum 26.04.1988 White Yes 112 Basri Bey 95 ETAEM/İZM T. aestivum 20.04.1995 White Yes 113 Kaşif Bey 95 ETAEM/İZM T. aestivum 20.04.1995 White Yes 114 Gönen 98 ETAEM/İZM T. aestivum 12.05.1998 White Yes 115 Ziyabey 98 ETAEM/İZM T. aestivum 12.05.1998 White Yes 116 Meta 2002 ETAEM/İZM T. aestivum 2.05.2002 White Yes 117 Alibey ETAEM/İZM T. aestivum 1.04.2004 White Yes 118 Menemen ETAEM/İZM T. aestivum 1.04.2004 White Yes 119 Çukurova 86 DATAEM/ADN T. aestivum 30.04.1986 Red Yes 120 Doğankent 1 DATAEM/ADN T. aestivum 26.04.1991 White Yes 121 Seri 82 DATAEM/ADN T. aestivum 26.04.1991 White Yes 122 Seyhan 95 DATAEM/ADN T. aestivum 20.04.1995 White Yes 123 Adana-99 DATAEM/ADN T. aestivum 26.04.1999 White Yes 124 Ceyhan-99 DATAEM/ADN T. aestivum 26.04.1999 White Yes 125 Balattila DATAEM/ADN T. aestivum 28.04.2000 White Yes 126 Pandas (Panda) DATAEM/ADN T. aestivum 24.04.2001 Red Yes 127 Yüreğir-89 DATAEM/ADN T. aestivum 2.05.2002 White Yes 128 Karatopak DATAEM/ADN T. aestivum 14.04.2006 White Yes 129 Osmaniyem DATAEM/ADN T. aestivum 14.04.2006 Red Yes 130 Altın Başak DATAEM/ADN T. aestivum 12.04.2013 White Yes 131 Gökkan DATAEM/ADN T. aestivum 12.04.2013 White Yes 132 Seri 2013 DATAEM/ADN T. aestivum 12.04.2013 White Yes 133 Yakamoz DATAEM/ADN T. aestivum 11.04.2014  -  Yes 134 Gemini DATAEM/ADN T. aestivum 11.04.2014  -  Yes 135 Abuşbey GAP-EYAM/ŞURF T. aestivum 30.07.2009 Red Yes 136 Tosun 21 Ankara Uni. Fac. Agric. T. aestivum 5.05.1975  - Yes 137 Tosun 144 Ankara Uni. Fac. Agric. T. aestivum 5.05.1975  - Yes 138 Köksal-2000 Uludağ Uni. Fac. Agric./BRS T. aestivum 24.04.2001 Red No 139 Genç 88 Çukurova Uni. Fac. Agric./ADN T. aestivum 26.04.1988 White Yes 140 Genç-99 Çukurova Uni. Fac. Agric./ADN T. aestivum 26.04.1999 White Yes 141 Özkan Çukurova Uni. Fac. Agric./ADN T. aestivum 23.06.2011 White Yes 142 Carisma TASACO /İST T. aestivum 8.04.2011 Red Yes Table 1. (Continued.) ALI et al. / Turk J Agric For 95 2.2. DNA isolation from fresh wheat leaf samples The seeds of registered Turkish bread wheat cultivars were sown in a greenhouse at the Department of Plant Protection, Sivas University of Science and Technology, for 35 days. DNA was extracted from fresh leaf samples using the cetyltrimethylammonium bromide (CTAB) method, as described by Doyle and Doyle (1990), and following a specific protocol recommended by Diversity Arrays Technology (Baloch et al., 2023). The quality and quantity of the extracted DNA were assessed using a nanodrop spectrophotometer (DS11 FX, DeNovix, Wilmington, DE, USA). 2.3. Primer optimization and PCR amplification The extracted DNA of wheat leaf samples was optimized for closely linked 16 SSR-Stb gene-specific primers using a gradient polymerase chain reaction (PCR). A total of 16 SSR Stb resistance gene-specific primers were utilized (Table 2). For PCR amplification, the Vazyme (2 × Phanta Max Master Mix (Dye Plus) P525; Vazyme Biotech Co., Ltd., Nanjing, China) was used, known for its super fidelity, longer and faster amplification, and wide adaptability. The reaction volume for each PCR was 10 µL, consisting of 5 µL of 2 × Phanta Max Master Mix, 0.5 µL (10 Pmol) of forward primer, 0.5 µL (10 Pmol) of reversed primer, 3 µL Stb genes and Marker Chr. Forward Primer Reverse Primer Annealing (Tm) Linkage Amplicon size (bp) Stb1 barc74 F/R 5BL F: 5′gcgcttgccccttcaggcgag3′, R:5′cgcgggagaaccaccagtgaca gagc3′ 58 °C 2.7 cM prox 175 Stb2 gwm389 F/R 1BS F: 5′atcatgtcgatctccttgacg3′ R: 5′tgccatgcacattagcagat3′ 58 °C 5 cM 117 Stb3 wmc83 F/R 7A F: 5′tggaggaaacacaatggatgcc3′ R: 5′gagtatcgccgacgaaagggaa3′ 58 °C 3 cM 160 Stb4 gwm111 F/R 7DS F: 5′tctgtaggctctctccgactg3′ R: 5′acctgatcagatcccactcg3′ 58 °C 0.7 cM 206 Stb5 gwm44 F/R 7DS F: 5′gttgagcttttcagttcggc3′ R: 5′actggcatccactgagctg3′ 58 °C 6-7 cM 178 Stb6 gwm369 F/R 3AS F: 5′ctgcaggccatgatgatg3′ R: 5′accgtgggtgttgtgagc3′ 58 °C Flanking 184 Stb7 gwm313 F/R 4AL F: 5′gcagtctaattatctgctggcg3′ R: 5′gggtccttgtctactcatgtct3′ 58 °C 0.3 cM distal 197 Stb12 wmc219 F/R 4AL F: 5′tgctagtttgtcatccgggcga3′ R: 5′caatcccgttctacaagttcca3′ 59 °C 0.8 cM distal 204 Stb8 gwm146 F/R 7BL F: 5′ccaaaaaaactgcctgcatg3′ R: 5′ctctggcattgctccttgg3′ 58 °C 3.5 cM 174 Stb9 wmc317 F/R 6AS F: 5′tgctagcaatgctccgggtaac3′ R: 5′tcacgaaaccttttcctcctcc3′ 58 °C 7 cM 139 Stb11 barc137 F/R 1BS F: 5′ggcccatttcccactttcca3′ R: 5′ccagcccctctacacatttt3′ 58 °C Flanking 260 Stb13 wmc396 F/R 7B F: 5′tgcactgttttaccttcacgga3′ R: 5′caaagcaagaaccagagccact3′ 58 °C 7-9 cM 146 Stb14 wmc623 F/R 3B F: 5′acgattggccacagaggag3′ R: 5′cagtgaccaatagtggaggtca3′ 60 °C 5 cM 192 Stb16 wmc494 F/R 3D F: 5′ggatcgagtctcaagtctacaa3′ R: 5′agaaggaacaagcaacatcata3′ 60 °C 1–5 cM 218 Stb17 hbg247 F/R 5A F: 5′acatgcggggatgatgattt3′ R: 5′gcggacccatgataaaatgtct3′ 60 °C 1–5 cM 259 Stb18 gpw3087 F/R 6DS F: 5′ctctaagaagtccaatgcaaca3′ R: 5′aattgcagaaactggatgcc3′ 60 °C 1–5 cM 166 The table delineates the Stb1–18 loci associated with resistance to Z. tritici blotch in wheat, specifically targeting the pathogen STB. Notably, the wheat genotypes were attributed to the A, B, and D genomes, with reference to the short (S) and long (L) arms of respective chromosomes. Table 2. List of the 16 SSR molecular markers used during the present study (Simón et al., 2012; Mekonnen et al., 2019). https://link.springer.com/article/10.1007/s10722-023-01804-4#ref-CR12 ALI et al. / Turk J Agric For 96 of nuclease-free (BioLabs GmbH, Heidelberg, Germany) water, and 1 µL (100 ng/uL) of template DNA, respectively. The PCR thermocycling protocol began with an initial denaturation at 95 °C for 4 min, followed by 35 cycles of denaturation at 95 °C for 15 s, annealing at an optimized temperature range of 58–60 °C specific to each primer for another 15 s, and extension at 72 °C for 15 s. A final extension step was performed at 68 °C for 5 min. Subsequently, the resultant PCR products were validated via electrophoresis on 2% agarose gel in 1 ×  Tris-borate- ethylenediaminetetraacetic acid buffer at 90 V for 80 min. The bands were visualized under ultraviolet light using a Gel Documentation System (Gel Doc XR+, Bio-Rad, Hercules, CA, USA). The amplified PCR product exhibited the expected size, with the amplicon length determined using a 100-bp DNA marker (ranging from 100 to 1500 bp) (Invitrogen Life Technologies, Waltham, MA, USA). 2.4. Statistical analysis The statistical analysis was performed utilizing the Minitab and SPSS software programs. 3. Results 3.1. Exploring the allelic diversity of Stb genes in Turkish bread wheat cultivars Results of the genotypic screening utilizing 16 SSR markers across 143 bread wheat genotypes released as commercial cultivars from various agriculture research institutes in Türkiye are presented in Table 3. The presence or absence of 16 key genes associated with resistance to Septoria tritici was determined based on the expected fragment sizes on agarose gel. Specifically, the 16 Stb resistance genes (Stb1, Stb2, Stb3, Stb4, Stb5, Stb6, Stb7, Stb8, Stb9, Stb11, Stb12, Stb13, Stb14, Stb16, Stb17, and Stb18) were identified by observing the PCR products on 2% agarose gel with fragment sizes corresponding to 175 bp, 117 bp, 160 bp, 206 bp, 178 bp, 184 bp, 197 bp, 204 bp, 174 bp, 139 bp, 260 bp, 146 bp, 192 bp, 218 bp, 259 bp, and 166 bp, respectively. The distribution (%) of Stb genes among the 143 bread wheat cultivars revealed significant variability. The frequency of each Stb gene ranged from 6.99% to 89.51%. Stb3 was the most prevalent gene, occurring in 89.51% of the evaluated cultivars, followed by Stb13 (71.32%), Stb4 (43.33%), Stb11 (41.55%), Stb16 (39.86%), Stb5 (38.46%), Stb6 (33.56%), Stb12 (28.67%), Stb14 (28.67%), Stb1 (27.77%), Stb7 (24.47%), Stb8 (24.47%), Stb2 (20.98%), Stb18 (16.78%), Stb17 (11.88%), and Stb9 (6.99%). A total of 783 Stb resistance genes were detected across the 143 wheat cultivars. Stb3 was the most frequently identified gene, present in 128 of the 783 genes (16.3%), followed by Stb13 (13%), Stb4 (7.9%), Stb11 (7.5%), Stb16 (7.3%), Stb5 (7.0%), Stb6 (6.1%), Stb12 (5.2%), Stb14 (5.2%), Stb1 (5%), Stb7 (4.5%), Stb8 (4.5%), Stb2 (3.8%), Stb18 (3.1%), Stb17 (2.2%), and Stb9 (1.3%), respectively (Figure 1). 3.2. PCR-based assessment of the Stb genes PCR-based screening targeting the Stb1 gene on chromosome 5BL revealed that 39 of the 143 evaluated registered cultivars exhibited a positive band size of 175 bp, confirming the presence of the resistance gene. Conversely, 104 cultivars (72.72%) did not produce the expected band size, indicating the absence of Stb1. PCR amplification using SSR marker gwm389 showed a band size of 117 bp in 30 cultivars (20.98%), indicating the presence of Stb2 in close linkage. In contrast, 113 genotypes did not produce the anticipated band size, suggesting the absence of Stb2. Furthermore, the investigation of Stb3 located on locus 7A using the primer wmc83, revealed a band size of 160 bp in 128 (89.51%) cultivars. Stb4 was examined using the marker gwm111 on chromosome 7DS, which yielded a band size of 206 bp in 62 (43.35%) cultivars. Stb5 on chromosome 7DS was also explored with the marker gwm44, resulting in a 178 bp band in 55 (38.46%) cultivars, confirming the presence of the gene. However, 61.53% of the genotypes did not produce the expected band size, indicating the absence of Stb5. Evaluation of Stb6 using the gwm369 marker on chromosome 3AS produced a positive band size of 184 bp in 48 (33.56%) cultivars. Screening for Stb7 and Stb12 with SSR markers gwm313 and wmc219 yielded positive amplification sizes of 197 bp and 204 bp in 35 and 41 genotypes, respectively. In contrast, 75.22% and 71.32% of the cultivars failed to produce bands with these markers, indicating the absence of Stb7 and Stb12. Markers gwm146 and wmc317 identified Stb8 on locus 7BL and Stb9 on chromosome 6AS in 35 and 10 cultivars, respectively. A 174-bp band with marker gwm146 confirmed the presence of Stb8, while a 139-bp amplicon with marker wmc317 demonstrated the presence of Stb9 (Figure 2). Similarly, the presence of Stb9 was indicated by a 139-bp amplicon obtained using the wmc317 marker. Stb9 was identified as having the lowest distribution rate among the tested germplasm, representing only 6.99% of the samples with this gene. Additionally, amplification using the barc137 marker produced a 260-bp amplicon in 59 (41.25%) cultivars, confirming the presence of Stb11 on chromosome 1B. Screening with the wmc396 primer for Stb13 yielded 146 bp-positive bands in 102 cultivars. Stb14 on locus 3B was detected using the marker wmc623, which showed a positive amplicon of 192 bp in 41 cultivars. Using the wmc494 primer, 57 genotypes exhibited a 218-bp positive band, confirming the presence of Stb16 on locus 3D. In contrast, 86 genotypes showed no amplification, indicating the absence of Stb14. Screening for Stb17 and Stb18 revealed positive amplification sizes of 259 bp and 166 bp, respectively, in 17 and 24 cultivars using the markers hbg247 and gpw3087. Among the tested cultivars, Stb17 had the second-lowest prevalence rate at 11.88%, just above Stb9 (Figure 3). ALI et al. / Turk J Agric For 97 Ta bl e 3. R es ul ts o f m ol ec ul ar sc re en in g of 1 43 h ist or ic al re gi st er ed T ur ki sh w he at c ul tiv ar s f or S tb re sis ta nc e ge ne s u sin g cl os el y lin ke d 16 S SR m ar ke rs . Sr . N o. Cu lti va rs n am e G en ot yp es Sr .N o. D at e of Re gi st ra tio n St b1 St b2 St b3 St b4 St b5 St b6 St b7 St b8 St b9 St b1 1 St b1 2 St b1 3 St b1 4 St b1 6 St b1 7 St b1 8 N o. o f de te ct ed S tb ge ne s 1 A nk ar a 09 3/ 44 1 7. 10 .1 96 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 6 2 Kö se 2 20 /3 9 2 7. 10 .1 96 3 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 7 3 Si va s 1 11 /3 3 3 7. 10 .1 96 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 5 4 Sü ra k M . 15 93 /5 1 4 7. 10 .1 96 3 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 2 5 4- 11 22 7. 10 .1 96 3 22 22 22 22 22 22 22 22 22 22 22 22 22 22 22 22 2 6 4- 22 23 7. 10 .1 96 3 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 23 4 7 P 8- 6 24 7. 10 .1 96 3 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 24 5 8 P 8- 8 25 7. 10 .1 96 3 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 6 9 Ya yl a 30 5 29 9. 04 .1 96 6 29 29 29 29 29 29 29 29 29 29 29 29 29 29 29 29 4 10 Ye kt ay 4 06 30 18 .0 3. 19 68 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 2 11 Po rs uk -2 86 0 93 19 .0 3. 19 68 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 93 6 12 Bo la l 2 97 3 31 27 .0 4. 19 70 31 31 31 31 31 31 31 31 31 31 31 31 31 31 31 31 5 13 K ıra ç 6 6 32 27 .0 4. 19 70 32 32 32 32 32 32 32 32 32 32 32 32 32 32 32 32 3 14 Po rs uk -2 90 3 13 6 5. 05 .1 97 5 13 6 13 6 13 6 13 6 13 6 13 6 13 6 13 6 13 6 13 6 13 6 13 6 13 6 13 6 13 6 13 6 7 15 Po rs uk -2 90 4 13 7 5. 05 .1 97 5 13 7 13 7 13 7 13 7 13 7 13 7 13 7 13 7 13 7 13 7 13 7 13 7 13 7 13 7 13 7 13 7 4 16 Po rs uk -2 80 0 33 13 .0 5. 19 76 33 33 33 33 33 33 33 33 33 33 33 33 33 33 33 33 5 17 Po rs uk -2 87 4 10 7 13 .0 5. 19 76 10 7 10 7 10 7 10 7 10 7 10 7 10 7 10 7 10 7 10 7 10 7 10 7 10 7 10 7 10 7 10 7 4 18 Po rs uk -2 84 4 77 12 .0 5. 19 77 77 77 77 77 77 77 77 77 77 77 77 77 77 77 77 77 6 19 Po rs uk -2 80 1 34 15 .0 5. 19 79 34 34 34 34 34 34 34 34 34 34 34 34 34 34 34 34 5 20 Po rs uk -2 83 0 63 15 .0 5. 19 79 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 8 21 H ay m an a 79 5 15 .0 5. 19 79 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 8 22 Po rs uk -2 80 2 35 25 .0 4. 19 85 35 35 35 35 35 35 35 35 35 35 35 35 35 35 35 35 5 23 Po rs uk -2 87 5 10 8 25 .0 4. 19 85 10 8 10 8 10 8 10 8 10 8 10 8 10 8 10 8 10 8 10 8 10 8 10 8 10 8 10 8 10 8 10 8 5 ALI et al. / Turk J Agric For 98 Ta bl e 3. (C on tin ue d. ) 24 Po rs uk -2 87 6 10 9 15 .1 0. 19 85 10 9 10 9 10 9 10 9 10 9 10 9 10 9 10 9 10 9 10 9 10 9 10 9 10 9 10 9 10 9 10 9 6 25 Po rs uk -2 88 6 11 9 30 .0 4. 19 86 11 9 11 9 11 9 11 9 11 9 11 9 11 9 11 9 11 9 11 9 11 9 11 9 11 9 11 9 11 9 11 9 3 26 Po rs uk -2 87 7 11 0 30 .0 4. 19 86 11 0 11 0 11 0 11 0 11 0 11 0 11 0 11 0 11 0 11 0 11 0 11 0 11 0 11 0 11 0 11 0 9 27 Po rs uk -2 83 2 65 26 .0 4. 19 88 65 65 65 65 65 65 65 65 65 65 65 65 65 65 65 65 4 28 Po rs uk -2 87 8 11 1 26 .0 4. 19 88 11 1 11 1 11 1 11 1 11 1 11 1 11 1 11 1 11 1 11 1 11 1 11 1 11 1 11 1 11 1 11 1 9 29 Po rs uk -2 90 6 13 9 26 .0 4. 19 88 13 9 13 9 13 9 13 9 13 9 13 9 13 9 13 9 13 9 13 9 13 9 13 9 13 9 13 9 13 9 13 9 4 30 Po rs uk -2 84 5 78 16 .0 4. 19 90 78 78 78 78 78 78 78 78 78 78 78 78 78 78 78 78 8 31 Po rs uk -2 84 6 79 16 .0 4. 19 90 79 79 79 79 79 79 79 79 79 79 79 79 79 79 79 79 9 32 G ün -9 1 6 26 .0 4. 19 91 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 4 33 Po rs uk -2 83 1 64 26 .0 4. 19 91 64 64 64 64 64 64 64 64 64 64 64 64 64 64 64 64 4 34 Po rs uk -2 88 7 12 0 26 .0 4. 19 91 12 0 12 0 12 0 12 0 12 0 12 0 12 0 12 0 12 0 12 0 12 0 12 0 12 0 12 0 12 0 12 0 6 35 Po rs uk -2 88 8 12 1 26 .0 4. 19 91 12 1 12 1 12 1 12 1 12 1 12 1 12 1 12 1 12 1 12 1 12 1 12 1 12 1 12 1 12 1 12 1 5 36 Po rs uk -2 80 3 36 17 .0 5. 19 94 36 36 36 36 36 36 36 36 36 36 36 36 36 36 36 36 5 37 Po rs uk -2 82 1 54 17 .0 5. 19 94 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 7 38 Po rs uk -2 80 4 37 20 .0 4. 19 95 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 6 39 Po rs uk -2 80 5 38 20 .0 4. 19 95 38 38 38 38 38 38 38 38 38 38 38 38 38 38 38 38 4 40 Po rs uk -2 87 9 11 2 20 .0 4. 19 95 11 2 11 2 11 2 11 2 11 2 11 2 11 2 11 2 11 2 11 2 11 2 11 2 11 2 11 2 11 2 11 2 6 41 Po rs uk -2 88 0 11 3 20 .0 4. 19 95 11 3 11 3 11 3 11 3 11 3 11 3 11 3 11 3 11 3 11 3 11 3 11 3 11 3 11 3 11 3 11 3 6 42 Po rs uk -2 88 9 12 2 20 .0 4. 19 95 12 2 12 2 12 2 12 2 12 2 12 2 12 2 12 2 12 2 12 2 12 2 12 2 12 2 12 2 12 2 12 2 2 43 İk iz ce 9 6 7 16 .0 4. 19 96 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 5 44 Po rs uk -2 80 6 39 6. 05 .1 99 7 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 39 5 45 Po rs uk -2 82 2 55 6. 05 .1 99 7 55 55 55 55 55 55 55 55 55 55 55 55 55 55 55 55 3 46 Po rs uk -2 84 7 80 6. 05 .1 99 7 80 80 80 80 80 80 80 80 80 80 80 80 80 80 80 80 8 47 Po rs uk -2 86 1 94 6. 05 .1 99 7 94 94 94 94 94 94 94 94 94 94 94 94 94 94 94 94 4 48 Po rs uk -2 86 2 95 6. 05 .1 99 7 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 5 ALI et al. / Turk J Agric For 99 Ta bl e 3. (C on tin ue d. ) 49 Po rs uk -2 86 3 96 6. 05 .1 99 7 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 7 50 M ız ra k 8 12 .0 5. 19 98 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 5 51 Tü rk m en 9 12 .0 5. 19 98 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 7 52 U zu ny ay la 10 12 .0 5. 19 98 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 5 53 Po rs uk -2 80 7 40 12 .0 5. 19 98 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 7 54 Po rs uk -2 80 8 41 12 .0 5. 19 98 41 41 41 41 41 41 41 41 41 41 41 41 41 41 41 41 8 55 Po rs uk -2 83 3 66 12 .0 5. 19 98 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 7 56 Po rs uk -2 88 1 11 4 12 .0 5. 19 98 11 4 11 4 11 4 11 4 11 4 11 4 11 4 11 4 11 4 11 4 11 4 11 4 11 4 11 4 11 4 11 4 2 57 Po rs uk -2 88 2 11 5 12 .0 5. 19 98 11 5 11 5 11 5 11 5 11 5 11 5 11 5 11 5 11 5 11 5 11 5 11 5 11 5 11 5 11 5 11 5 4 58 Po rs uk -2 85 4 87 12 .0 5. 19 98 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 9 59 Ya ka r- 99 11 26 .0 4. 19 99 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 3 60 Po rs uk -2 80 9 42 26 .0 4. 19 99 42 42 42 42 42 42 42 42 42 42 42 42 42 42 42 42 6 61 Po rs uk -2 82 3 56 26 .0 4. 19 99 56 56 56 56 56 56 56 56 56 56 56 56 56 56 56 56 6 62 Po rs uk -2 82 4 57 26 .0 4. 19 99 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 8 63 Po rs uk -2 83 4 67 26 .0 4. 19 99 67 67 67 67 67 67 67 67 67 67 67 67 67 67 67 67 6 64 Po rs uk -2 83 5 68 26 .0 4. 19 99 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 6 65 Po rs uk -2 89 0 12 3 26 .0 4. 19 99 12 3 12 3 12 3 12 3 12 3 12 3 12 3 12 3 12 3 12 3 12 3 12 3 12 3 12 3 12 3 12 3 5 66 Po rs uk -2 89 1 12 4 26 .0 4. 19 99 12 4 12 4 12 4 12 4 12 4 12 4 12 4 12 4 12 4 12 4 12 4 12 4 12 4 12 4 12 4 12 4 6 67 Po rs uk -2 90 7 14 0 26 .0 4. 19 99 14 0 14 0 14 0 14 0 14 0 14 0 14 0 14 0 14 0 14 0 14 0 14 0 14 0 14 0 14 0 14 0 3 68 A ks el 2 00 0 12 28 .0 4. 20 00 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 12 4 69 Ba yr ak ta r 2 00 0 13 28 .0 4. 20 00 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 13 4 70 D em ir 20 00 14 28 .0 4. 20 00 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 14 3 71 Po rs uk -2 81 0 43 28 .0 4. 20 00 43 43 43 43 43 43 43 43 43 43 43 43 43 43 43 43 2 72 Po rs uk -2 81 1 44 28 .0 4. 20 00 44 44 44 44 44 44 44 44 44 44 44 44 44 44 44 44 5 ALI et al. / Turk J Agric For 100 Ta bl e 3. (C on tin ue d. ) 73 Po rs uk -2 86 4 97 28 .0 4. 20 00 97 97 97 97 97 97 97 97 97 97 97 97 97 97 97 97 5 74 Po rs uk -2 89 2 12 5 28 .0 4. 20 00 12 5 12 5 12 5 12 5 12 5 12 5 12 5 12 5 12 5 12 5 12 5 12 5 12 5 12 5 12 5 12 5 5 75 Po rs uk -2 86 5 98 28 .0 4. 20 00 98 98 98 98 98 98 98 98 98 98 98 98 98 98 98 98 7 76 Po rs uk -2 81 2 45 24 .0 4. 20 01 45 45 45 45 45 45 45 45 45 45 45 45 45 45 45 45 6 77 Po rs uk -2 81 3 46 24 .0 4. 20 01 46 46 46 46 46 46 46 46 46 46 46 46 46 46 46 46 2 78 Po rs uk -2 81 4 47 24 .0 4. 20 01 47 47 47 47 47 47 47 47 47 47 47 47 47 47 47 47 4 79 Po rs uk -2 83 6 69 24 .0 4. 20 01 69 69 69 69 69 69 69 69 69 69 69 69 69 69 69 69 4 80 Po rs uk -2 83 7 70 24 .0 4. 20 01 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 7 81 Po rs uk -2 84 8 81 24 .0 4. 20 01 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 9 82 Po rs uk -2 84 9 82 24 .0 4. 20 01 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 6 83 Po rs uk -2 85 5 88 24 .0 4. 20 01 88 88 88 88 88 88 88 88 88 88 88 88 88 88 88 88 5 84 Po rs uk -2 89 3 12 6 24 .0 4. 20 01 12 6 12 6 12 6 12 6 12 6 12 6 12 6 12 6 12 6 12 6 12 6 12 6 12 6 12 6 12 6 12 6 6 85 Po rs uk -2 90 5 13 8 24 .0 4. 20 01 13 8 13 8 13 8 13 8 13 8 13 8 13 8 13 8 13 8 13 8 13 8 13 8 13 8 13 8 13 8 13 8 2 86 At lı- 20 02 15 2. 05 .2 00 2 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 5 87 Ze nc irc i-2 00 2 16 2. 05 .2 00 2 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 9 88 Po rs uk -2 81 5 48 2. 05 .2 00 2 48 48 48 48 48 48 48 48 48 48 48 48 48 48 48 48 5 89 Po rs uk -2 82 5 58 2. 05 .2 00 2 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 9 90 Po rs uk -2 82 6 59 2. 05 .2 00 2 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 9 91 Po rs uk -2 85 0 83 2. 05 .2 00 2 83 83 83 83 83 83 83 83 83 83 83 83 83 83 83 83 6 92 Po rs uk -2 85 1 84 2. 05 .2 00 2 84 84 84 84 84 84 84 84 84 84 84 84 84 84 84 84 7 93 Po rs uk -2 86 9 10 2 2. 05 .2 00 2 10 2 10 2 10 2 10 2 10 2 10 2 10 2 10 2 10 2 10 2 10 2 10 2 10 2 10 2 10 2 10 2 7 94 Po rs uk -2 88 3 11 6 2. 05 .2 00 2 11 6 11 6 11 6 11 6 11 6 11 6 11 6 11 6 11 6 11 6 11 6 11 6 11 6 11 6 11 6 11 6 4 95 Po rs uk -2 89 4 12 7 2. 05 .2 00 2 12 7 12 7 12 7 12 7 12 7 12 7 12 7 12 7 12 7 12 7 12 7 12 7 12 7 12 7 12 7 12 7 5 96 Es er 17 2. 05 .2 00 3 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 17 9 ALI et al. / Turk J Agric For 101 Ta bl e 3. (C on tin ue d. ) 97 Po rs uk -2 87 0 10 3 2. 05 .2 00 3 10 3 10 3 10 3 10 3 10 3 10 3 10 3 10 3 10 3 10 3 10 3 10 3 10 3 10 3 10 3 10 3 8 98 Se va l 18 1. 04 .2 00 4 18 18 18 18 18 18 18 18 18 18 18 18 18 18 18 18 8 99 To su nb ey 19 1. 04 .2 00 4 19 19 19 19 19 19 19 19 19 19 19 19 19 19 19 19 5 10 0 Po rs uk -2 82 7 60 1. 04 .2 00 4 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 4 10 1 Po rs uk -2 82 8 61 1. 04 .2 00 4 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 6 10 2 Po rs uk -2 87 1 10 4 1. 04 .2 00 4 10 4 10 4 10 4 10 4 10 4 10 4 10 4 10 4 10 4 10 4 10 4 10 4 10 4 10 4 10 4 10 4 9 10 3 Po rs uk -2 88 4 11 7 1. 04 .2 00 4 11 7 11 7 11 7 11 7 11 7 11 7 11 7 11 7 11 7 11 7 11 7 11 7 11 7 11 7 11 7 11 7 5 10 4 Po rs uk -2 88 5 11 8 1. 04 .2 00 4 11 8 11 8 11 8 11 8 11 8 11 8 11 8 11 8 11 8 11 8 11 8 11 8 11 8 11 8 11 8 11 8 4 10 5 Po rs uk -2 83 8 71 30 .0 3. 20 05 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 6 10 6 Po rs uk -2 83 9 72 30 .0 3. 20 05 72 72 72 72 72 72 72 72 72 72 72 72 72 72 72 72 10 10 7 Po rs uk -2 81 6 49 14 .0 4. 20 06 49 49 49 49 49 49 49 49 49 49 49 49 49 49 49 49 5 10 8 Po rs uk -2 89 5 12 8 14 .0 4. 20 06 12 8 12 8 12 8 12 8 12 8 12 8 12 8 12 8 12 8 12 8 12 8 12 8 12 8 12 8 12 8 12 8 6 10 9 Po rs uk -2 89 6 12 9 14 .0 4. 20 06 12 9 12 9 12 9 12 9 12 9 12 9 12 9 12 9 12 9 12 9 12 9 12 9 12 9 12 9 12 9 12 9 6 11 0 Po rs uk -2 86 6 99 5. 04 .2 00 7 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 6 11 1 Po rs uk -2 86 7 10 0 5. 04 .2 00 7 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 7 11 2 Po rs uk -2 81 7 50 2. 04 .2 00 8 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 8 11 3 Po rs uk -2 85 6 89 2. 04 .2 00 8 89 89 89 89 89 89 89 89 89 89 89 89 89 89 89 89 7 11 4 Ke na nb ey 20 6. 04 .2 00 9 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 3 11 5 Po rs uk -2 84 0 73 6. 04 .2 00 9 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 7 11 6 Po rs uk -2 84 1 74 6. 04 .2 00 9 74 74 74 74 74 74 74 74 74 74 74 74 74 74 74 74 6 11 7 Po rs uk -2 90 2 13 5 30 .0 7. 20 09 13 5 13 5 13 5 13 5 13 5 13 5 13 5 13 5 13 5 13 5 13 5 13 5 13 5 13 5 13 5 13 5 4 11 8 Lü tfi be y 21 30 .0 3. 20 10 21 21 21 21 21 21 21 21 21 21 21 21 21 21 21 21 2 11 9 Po rs uk -2 81 8 51 30 .0 3. 20 10 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 4 12 0 Po rs uk -2 84 2 75 30 .0 3. 20 10 75 75 75 75 75 75 75 75 75 75 75 75 75 75 75 75 4 12 1 Po rs uk -2 85 3 86 30 .0 3. 20 10 86 86 86 86 86 86 86 86 86 86 86 86 86 86 86 86 10 12 2 Po rs uk -2 85 2 85 8. 04 .2 01 1 85 85 85 85 85 85 85 85 85 85 85 85 85 85 85 85 7 ALI et al. / Turk J Agric For 102 12 3 Po rs uk -2 90 8 14 1 23 .0 6. 20 11 14 1 14 1 14 1 14 1 14 1 14 1 14 1 14 1 14 1 14 1 14 1 14 1 14 1 14 1 14 1 14 1 3 12 4 Po rs uk -2 90 9 14 2 8. 04 .2 01 1 14 2 14 2 14 2 14 2 14 2 14 2 14 2 14 2 14 2 14 2 14 2 14 2 14 2 14 2 14 2 14 2 1 12 5 Po rs uk -2 91 0 14 3 8. 04 .2 01 1 14 3 14 3 14 3 14 3 14 3 14 3 14 3 14 3 14 3 14 3 14 3 14 3 14 3 14 3 14 3 14 3 2 12 6 Po rs uk -2 81 9 52 17 .0 4. 20 12 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 7 12 7 Po rs uk -2 82 9 62 17 .0 4. 20 12 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 8 12 8 Po rs uk -2 87 3 10 6 17 .0 4. 20 12 10 6 10 6 10 6 10 6 10 6 10 6 10 6 10 6 10 6 10 6 10 6 10 6 10 6 10 6 10 6 10 6 6 12 9 Po rs uk -2 82 0 53 12 .0 4. 20 13 53 53 53 53 53 53 53 53 53 53 53 53 53 53 53 53 6 13 0 Po rs uk -2 85 7 90 12 .0 4. 20 13 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 6 13 1 Po rs uk -2 89 7 13 0 12 .0 4. 20 13 13 0 13 0 13 0 13 0 13 0 13 0 13 0 13 0 13 0 13 0 13 0 13 0 13 0 13 0 13 0 13 0 4 13 2 Po rs uk -2 89 8 13 1 12 .0 4. 20 13 13 1 13 1 13 1 13 1 13 1 13 1 13 1 13 1 13 1 13 1 13 1 13 1 13 1 13 1 13 1 13 1 3 13 3 Po rs uk -2 89 9 13 2 12 .0 4. 20 13 13 2 13 2 13 2 13 2 13 2 13 2 13 2 13 2 13 2 13 2 13 2 13 2 13 2 13 2 13 2 13 2 1 13 4 Po rs uk -2 84 3 76 11 .0 4. 20 14 76 76 76 76 76 76 76 76 76 76 76 76 76 76 76 76 6 13 5 Po rs uk -2 85 8 91 11 .0 4. 20 14 91 91 91 91 91 91 91 91 91 91 91 91 91 91 91 91 5 13 6 Po rs uk -2 86 8 10 1 11 .0 4. 20 14 10 1 10 1 10 1 10 1 10 1 10 1 10 1 10 1 10 1 10 1 10 1 10 1 10 1 10 1 10 1 10 1 10 13 7 Po rs uk -2 87 2 10 5 11 .0 4. 20 14 10 5 10 5 10 5 10 5 10 5 10 5 10 5 10 5 10 5 10 5 10 5 10 5 10 5 10 5 10 5 10 5 7 13 8 Po rs uk -2 90 0 13 3 11 .0 4. 20 14 13 3 13 3 13 3 13 3 13 3 13 3 13 3 13 3 13 3 13 3 13 3 13 3 13 3 13 3 13 3 13 3 7 13 9 M el ez 26 11 .0 4. 20 14 26 26 26 26 26 26 26 26 26 26 26 26 26 26 26 26 7 14 0 A k 70 2 27 11 .0 4. 20 14 27 27 27 27 27 27 27 27 27 27 27 27 27 27 27 27 3 14 1 Se rt ak 28 11 .0 4. 20 14 28 28 28 28 28 28 28 28 28 28 28 28 28 28 28 28 2 14 2 Po rs uk -2 85 9 92 11 .0 4. 20 14 92 92 92 92 92 92 92 92 92 92 92 92 92 92 92 92 6 14 3 Po rs uk -2 90 1 13 4 11 .0 4. 20 14 13 4 13 4 13 4 13 4 13 4 13 4 13 4 13 4 13 4 13 4 13 4 13 4 13 4 13 4 13 4 13 4 4 To ta l N o. o f de te ct ed S tb ge ne s 39 30 12 8 62 55 48 35 35 10 59 41 10 2 41 57 17 24 78 3 *B ox es in g re en sh ow th e pr es en ce o f S tb re sis ta nc e ge ne s, an d th os e in w hi te d em on st ra te th e ab se nc e of S tb re sis ta nc e ge ne s. ** Th e re su lts a re a rr an ge d ac co rd in g to th e ye ar . Ta bl e 3. (C on tin ue d. ) ALI et al. / Turk J Agric For 103 The analysis indicated that three released commercial cultivars (Porsuk-2811, Porsuk-2853, and Porsuk-2868) each possessed 10 resistance genes. Additionally, 20 cultivars had 17 resistance genes, 19 had 7 genes, 28 had 6 genes, 27 had 5 genes, 23 had 4 genes, 10 had 3 genes, 11 had 2 genes, and the remaining two cultivars each had one significant Stb gene (Table 3 and Figure 4). 3.3. Temporal assessment of allelic variation in the Stb genes across the bread wheat cultivars over successive years (1963–2014) The year-wise analysis of commercial Turkish bread wheat cultivars revealed significant variation in the allele diversity of the Stb genes. A total of 143 bread wheat cultivars released between 1963 and 2014 (Figure 5) were evaluated. Figure 1. A summary of the Stb resistance genes highlighting the distribution of Stb genes in 143 registered Turkish bread wheat genotypes released as commercial cultivars between 1963 and 2014. Figure 2. The 2% agarose gel showing the SSR marker results obtained from a specific set of 143 bread wheat cultivars. The utilized primer pairs encompassed xbarc74 (a), gwm389 (b), wmc83 (c), gwm111 (d), gwm44 (e), gwm369 (f), gwm313 (g), gwm146 and (h), xgwm317. A 100-bp size marker (100–1500 bp) was used during the study. ALI et al. / Turk J Agric For 104 For 1963–1969, 11 cultivars were analyzed, revealing a maximum number of 49 Stb genes. Among these, Stb3 and Stb4 were detected at frequencies of 90.90% and 81.81% respectively, while no resistance genes were detected for Stb9, Stb12, Stb16, and Stb17. For 1970–1979, a total of 10 of 143 cultivars were analyzed, and 55 Stb genes were detected, with Stb3 and Stb4 both present at a frequency of 80%, with no detection of Stb17. For 1980–1989, 8 cultivars were examined, and 45 Stb genes were identified. Stb3 and Stb14 were detected at frequencies of 87.50%, while no resistance genes were detected for Stb8, Stb9, Stb17, and Stb18. For 1990–2000, 46 cultivars were assessed, and 247 Stb genes were identified, with Stb3 and Stb13 present at frequencies of 16.19% and 13.76% respectively. For 2001–2010, 46 cultivars were analyzed, and 275 Stb genes were detected, with Stb3 and Stb13 present at frequencies of 16% and 11.63%. Finally, for 2011–2014, 22 of the 143 cultivars were evaluated and 111 Stb genes were identified, with Stb3 and Stb13 present at frequencies of 17.11% and 11.71%, respectively.  Figure 3. The 2% agarose gel showing the SSR marker results obtained from a specific set of 143 bread wheat cultivars. The utilized primer pairs encompassed (i), xbarc137 (j), wmc219 (k), wmc396 (l), wmc623 (m), gwm494 (n), hbg247 (o), and gpw3087 (p). A 100-bp size marker (100–1500 bp) was used during the study. Figure 4. Brief summary highlighting the distribution pattern of the Stb genes across 143 registered Turkish bread wheat cultivars. ALI et al. / Turk J Agric For 105 4. Discussion Resistance breeding has emerged as a suitable and environmentally friendly strategy for managing several biotic diseases, especially for STB. Currently, molecular markers are extensively used in wheat breeding initiatives to speed up the detection, identification, characterization, and deployment of resistant genes (Downie et al., 2021; Elshafei et al., 2021; Luo et al., 2023; Baloch et al., 2023). DNA molecular markers, especially those closely linked to valuable genomic traits, serve as pivotal chromosomal landmarks. They act as indicators or guides in identifying or incorporation of targeted genes that govern the desired traits within the breeding materials. The present study involved the screening of 143 bread wheat genotypes released as commercial cultivars from various agricultural research institutes, to assess the presence of 16 Stb resistance genes against the STB. These genes included Stb1 (barc74), Stb2 (gwm389), Stb3 (wmc83), Stb4 (gwm111), Stb5 (gwm44), Stb6 (gwm369), Stb7 (gwm313), Stb12 (wmc219), Stb8 (gwm146), Stb9 (wmc317), Stb11 (barc137), Stb13 (wmc396), Stb14 (wmc623), Stb16 (wmc494), Stb17 (hbg247), and Stb18 (gpw3087). The findings revealed significant variation existing among the tested cultivars regarding the presence of these resistance genes. The allelic frequency of these Stb genes ranged from 6.99% to 89.51% for Stb9 and Stb3, with Stb3 being the most prevalent, found in 89.51% of the tested germplasm. This was followed by Stb13 (71.32%), Stb4 (43.33%), Stb11 (41.25%), Stb16 (39.86%), Stb5 (38.46%), Stb6 (33.56%), Stb12 (28.67%), Stb14 (28.67%), Stb1 (27.77%), Stb7 (24.47%), Stb8 (24.47%), Stb2 (20.98%), Stb18 (16.78%), Stb17 (11.88%), and Stb9 (6.99%). In comparison, Mekonnen et al. (2019) reported an allelic frequency for Stb resistance genes ranging from 6.67% and 96.1% for Stb12 and Stb3 in 180 bread wheat germplasm using 16 SSR markers. Chedli et al. (2022) observed a high level of genetic variation among 162 Z. tritici isolates using 12 SSR markers in Tunisia. Furthermore, the application of closely linked SSR markers to identify the resistant genes has been widely applied to wheat and other crops (Rajpoot et al., 2023; Baloch et al., 2023; Narayanswami et al., 2023; Yadav et al., 2024). Singh et al. (2015) described the allelic frequencies ranged from 19.8% to 54.7% across 192 rice genotypes screened for Pyricularia orizae resistance genes, utilizing 10 SSR markers. Furthermore, Imam et al. (2014) reported a genetic frequency ranged from 6% to 97% in rice germplasm tested for resistance genes against P. orizae. Molecular marker-based screening methods are very useful for finding specific genomic regions that control desirable resistance trait across the diverse germplasm. Yang et al. (2018) identified a novel resistance gene Stb19 on the short arm of chromosome 1D in wheat against Z. tritici using 43 Kompetitive allele-specific PCR markers. This r gene confers resistance to three Z. tritici accessions, WAI161, WAI251, and WAI332, at the seedling stage. Arraiano and Brown (2017) conducted a comprehensive screening of bread wheat germplasm spanning from 1860 to 2000 to find out the resistance and susceptible source to Z. tritici using the SSR/microsatellite markers and diversity array technology and reported several Stb resistance genes, including Stb5, Stb6, Stb7, Stb8, Stb9, Stb10, Stb11, Stb12, Stb14, Stb15, and Stb18. They identified multiple quantitative trait loci associated with resistance to Z. tritici, utilizing the best linear unbiased prediction method to distinguish between susceptible and resistant alleles in both spring and winter wheat. Earlier studies have similarly identified Stb resistance genes in wheat germplasm using various molecular markers (Adhikari et al., 2004a, 2004b; Brown et al., 2015; Arraiano et al., 2007; Tidd et al., 2023). Therefore, the use of molecular markers remains a vital and reliable approach for advancing wheat breeding programs targeting Z. tritici resistance. Figure 5. Decadal summary of the existence of allelic diversity in Stb genes among registered Turkish bread wheat cultivars (1963–2014). ALI et al. / Turk J Agric For 106 The screening of the present wheat germplasm exhibited 23 cultivars harboring 8 to 10 Z. tritici resistance genes. The results revealed significant allelic diversity of Stb genes across 143 bread wheat cultivars released between 1963 and 2014. According to Gökgöl (1939), Turkish wheat germplasm hold a high level of genetic diversity, playing s a major role in global wheat breeding programs. The current study confirmed that historical registered Turkish cultivars retained most of the Stb resistance genes. For example, cultivar Köse 220/39, registered in 1963, contained seven Stb resistance genes (Stb2, Stb3, Stb4, Stb5, Stb6, Stb7, and Stb13), followed by Ankara 093/44, p. 8–8, and Porsuk-2860, which each contained six resistance genes. Similarly, cultivars Porsuk-2830 and Haymana, registered in 1979, contained eight Stb resistance genes each, followed by other notable cultivars, including Porsuk-2903, Porsuk-2844, Porsuk-2800, and Porsuk-2801, which contained seven, six, five, and six Stb resistance genes, respectively. Porsuk-2830 contained Stb1, Stb2, Stb3, Stb4, Stb6, Stb11, Stb14, and Stb16, while Haymana contained Stb3, Stb4, Stb5, Stb6, Stb9, Stb13, Stb14, and Stb18 resistance genes. Furthermore, cultivars Porsuk-2877 and Porsuk-2878, registered in 1986 and 1988, contained nine Stb resistance genes each (Stb1, Stb2, Stb3, Stb4, Stb5, Stb6, Stb7, Stb13, and Stb16 in Porsuk-2877 and Stb1, Stb2, Stb3, Stb4, Stb5, Stb6, Stb7, Stb13, and Stb14 in Porsuk-2878), followed by Porsuk-2878, which contained six Stb resistance genes. Cultivar Porsuk-2846, registered in 1990, comprised nine resistance genes (Stb3, Stb5, Stb6, Stb7, Stb11, Stb12, Stb13, Stb16, and Stb18), while Porsuk-2854, registered in 1998, contained nine resistance genes (Stb3, Stb5, Stb7, Stb8, Stb9, Stb11, Stb13, Stb14, and Stb16), followed by Porsuk-2845, Porsuk-2847, Porsuk-2808, and Porsuk-2824, which contained eight Stb resistance genes each. Porsuk-2839, registered in 2005, contained ten Stb resistance genes (Stb3, Stb4, Stb8, Stb9, Stb12, Stb13, Stb14, Stb16, Stb17, and Stb18), while Porsuk-2853, registered in 2010, contained ten Stb resistance genes (Stb3, Stb5, Stb6, Stb7, Stb8, Stb9, Stb11, Stb13, Stb14, and Stb17), followed by Porsuk-2848, Zencirci-2002, Porsuk-2825, Porsuk-2826, Eser, and Porsuk-2871, which contained nine Stb resistance genes each. Finally, Porsuk-2868, registered in 2014, contained ten Stb resistance genes (Stb2, Stb3, Stb4, Stb5, Stb8, Stb9, Stb11, Stb12, Stb13, and Stb16), while Porsuk-2829, registered in 2012, contained eight Stb resistance genes. In summary, the maximum number of Stb resistance genes, 275 out of 783 (35.12%), was detected in cultivars from 2001 to 2010, followed by 1990 to 2000 (31.54%), 2011 to 2014 (14.17%), 1970 to 1979 (7.02%), 1963 to 1969 (6.25%), and 1980 to 1989 (5.74%). These results revealed that the registered Turkish wheat cultivars have significantly modified their genetic makeup in response to climate conditions and have demonstrated resistance to pathogens, including STB. National wheat breeding programs can greatly benefit from the data presented herein, particularly in developing Stb resistance varieties and/or long-lasting resistance through gene pyramiding. Accelerating the release of these promising cultivars, utilizing advanced molecular breeding and testing processes, could greatly enhance wheat production and efficiency in Türkiye. The findings of this study are crucial in mitigating the impact of STB on wheat yields and supporting global initiatives to ensure food and nutritional security, especially within Türkiye. 5. Conclusion This study utilized validated SSR markers to screen 143 registered bread wheat genotypes released as commercial cultivars for 16 key genes associated with resistance to STB. The results revealed significant variability in the presence of resistance genes among the cultivars. Stb3 was the most prevalent gene, detected in 89.51% of the cultivars, followed by Stb13, detected in 71.32%. The genetic frequency of the Stb genes ranged from 6.99% to 89.51%. In total, 783 resistance genes were identified, with Stb3 comprising 16.3% of the total. This study highlights the diverse genetic resistance to Z. tritici in these registered bread wheat cultivars. To the best of our knowledge, this is the first comprehensive study that provides valuable insights for the national breeding program aimed at developing new resistant varieties for sustainable wheat yield production and STB resistance breeding. Acknowledgments All the authors substantially contributed to the conception and design of the original research article, interpreted the relevant literature, and were involved in writing this original research article. Author contributions Methodology: AA, MT, PM, and MTA; Validation: FÖ and FSB; Formal analysis: JYG, MAN and EBT; Investigation: FSB and MA; Data curation: AA, FSB; Writing—original draft preparation: AA, AAD, HA, JJ, and PM; Review and editing: FSB and MAN; Supervision: FSB, JYG, and FÖ. All the authors have read and approved the final version of the manuscript. Funding This research work was funded by Biological Breeding- National Science and Technology Major Project (2023ZD04025). ALI et al. / Turk J Agric For 107 Conflict of interest The authors declare that they have no conflicts of interest. Ethical approval This study did not contain any research activities involving animals or human participants performed by any of the authors. Data availability All the data needed to conduct this study are provided within the manuscript. References Adhikari TB, Cavaletto JR, Dubcovsky J, Gieco J, Schlatter AR et al. (2004a). Molecular mapping of the Stb4 gene for resistance to septoria tritici blotch in wheat. Phytopathology 94: 1198-1206. https://doi.org/10.1094/PHYTO.2004.94.11.1198 Adhikari TB, Wallwork H, Goodwin SB (2004b). Microsatellite markers linked to the Stb2 and Stb3 genes for resistance to Septoria tritici blotch in wheat. Crop Science 44: 1403-1411. https://doi.org/10.2135/cropsci2004.1403 Aktaş H, Baloch FS (2017). Allelic variations of glutenin subunits and their association with quality traits in bread wheat genotypes. Turkish Journal of Agriculture and Forestry 41 (2): 127-134. Ali A, Ölmez F, Zeshan MA, Mubeen M, Iftikhar Y et al. (2024). Yeast- Based Solutions in Controlling Plant Pathogens.  Biocatalysis and Agricultural Biotechnology 103199. https://doi. org/10.1016/j.bcab.2024.103199 Altaf MT, Nadeem MA, Ali A, Liaqat W, Bedir M et al. (2024a). Applicability of Start Codon Targeted (SCoT) markers for the assessment of genetic diversity in bread wheat germplasm.  Genetic Resources and Crop Evolution 1-14. https://doi.org/10.1007/s10722-024-02016-0. Altaf MT, Liaqat W, Bedir M, Ali A, Nadeem MA et al. (2024b). Wheat Biofortification: A Promising Approach to Improve Public Health. In: Zencirci N, Altay F, Baloch FS, Nadeem MA, Ludidi N (eds) Advances in Wheat Breeding. Springer, Singapore. https://doi.org/10.1007/978-981-99-9478-6_16. Altaf MT, Nadeem MA, Ali A, Liaqat W, Bedir M et al. (2024c). Applicability of Start Codon Targeted (SCoT) markers for the assessment of genetic diversity in bread wheat germplasm.  Genetic Resources and Crop Evolution 1-14. https://doi.org/10.1007/s10722-024-02016-0 Altay F (2018). Cumhuriyetten günümüze buğday çalışmaları sunumu. Türkiye yerel buğdaylar sempozyumu. 20-22 December 2018, Bolu Türkiye (in Turkish). Arraiano LS, Brown JK (2017). Sources of resistance and susceptibility to Septoria tritici blotch of wheat.  Molecular Plant Pathology  18 (2): 276-292. https://doi.org/10.1111/ mpp.12482 Arraiano LS, Brown JKM (2006). Identification of isolate‐specific and partial resistance to septoria tritici blotch in 238 European wheat cultivars and breeding lines. Plant Pathology 55 (6): 726- 738. https://doi.org/10.1111/j.1365-3059.2006.01444.x Arraiano LS, Chartrain L, Bossolini E, Slatter HN, Keller B et al. (2007). A gene in European wheat cultivars for resistance to an African isolate of Mycosphaerella graminicola. Plant Pathology 56 (1): 73- 78.https://doi.org/10.1111/j.1365-3059.2006.01499.x Arraiano LS, Worland AJ, Ellerbrook C, Brown JK (2001). Chromosomal location of a gene for resistance to Septoria tritici blotch (Mycosphaerella graminicola) in the hexaploid wheat ‘synthetic 6x’. Theoretical and Appllied Genetics 103: 758-764. https://doi.org/10.1007/s001220100668 Atak M (2017). Wheat and Türkiye wheat village varieties. Journal of Agricultural Sciences 22 (2): 71-88. Bakala HS, Mandahal KS, Ankita, Sarao LK, Srivastava P (2021). Breeding wheat for biotic stress resistance: Achievements, challenges and prospects.  In: Mahmood-ur-Rahman A (editors). Current Trends in Wheat Research. London, SW7 2QJ, United Kingdom, IntechOpen, pp. 17-46. Baloch FS, Ali A, Tajibayev D, Nadeem MA, Ölmez F et al. (2023). Stripe rust resistance gene Yr15 in Turkish and Kazakhstan wheat germplasms and the potential of Turkish wild emmer for stripe rust breeding. Genetic Resources and Crop Evolutions 70: 1-21. https://doi.org/10.1007/s10722-023-01804-4 Brading PA, Verstappen ECP, Kema GHJ, Brown JKM (2002). A gene for-gene relationship between wheat and Mycosphaerella graminicola, the Septoria tritici blotch pathogen. Phytopathology 92: 439-445. https://doi.org/10.1094/ PHYTO.2002.92.4.439 Brown JK, Chartrain L, Lasserre-Zuber P, Saintenac C (2015). Genetics of resistance to Zymoseptoria tritici and applications to wheat breeding. Fungal Genetic Biology 79: 33-41. https:// doi.org/10.1016/j.fgb.2015.04.017 Chartrain L, Berry ST, Brown JKM (2005a). Resistance of wheat line Kavkaz-K4500 L.6.A.4 to septoria tritici blotch controlled by isolate-specific resistance genes. Phytopathology 95: 664-671. https://doi.org/10.1094/PHYTO-95-0664 https://doi.org/10.1094/PHYTO.2004.94.11.1198 https://doi.org/10.2135/cropsci2004.1403 https://doi.org/10.1016/j.bcab.2024.103199 https://doi.org/10.1016/j.bcab.2024.103199 https://doi.org/10.1007/s10722-024-02016-0 https://doi.org/10.1007/978-981-99-9478-6_16 https://doi.org/10.1007/s10722-024-02016-0 https://doi.org/10.1111/mpp.12482 https://doi.org/10.1111/mpp.12482 https://doi.org/10.1111/j.1365-3059.2006.01444.x https://doi.org/10.1111/j.1365-3059.2006.01499.x https://doi.org/10.1007/s001220100668 https://doi.org/10.1007/s10722-023-01804-4 https://doi.org/10.1094/PHYTO.2002.92.4.439 https://doi.org/10.1094/PHYTO.2002.92.4.439 https://doi.org/10.1016/j.fgb.2015.04.017 https://doi.org/10.1016/j.fgb.2015.04.017 https://doi.org/10.1094/PHYTO-95-0664 ALI et al. / Turk J Agric For 108 Chartrain L, Brading PA, Brown JKM (2005b). Presence of the Stb6 gene for resistance to septoria tritici blotch (Mycosphaerella graminicola) in cultivars used in wheatbreeding programmes worldwide. Plant Pathology 54: 134-143. https://doi. org/10.1111/j.1365-3059.2005.01164.x Chartrain L, Sourdille P, Bernard M, Brown JKM (2009). Identification and location of Stb9, a gene for resistance to septoria tritici blotch in wheat cultivars Courtot and tonic. Plant Pathology 58: 547-555. https://doi.org/10.1111/j.1365- 3059.2008.02013.x Chedli RBH, Aouini L, Barek SB, Bahri BA, Verstappen E et al (2022). Genetic diversity and population structure of Zymoseptoria tritici on bread wheat in Tunisia using SSR markers. European Journal of Plant Pathology 163 (2): 429-440. https://doi. org/10.1007/s10658-022-02486-x Cooper R (2015). Re-discovering ancient wheat varieties as functional foods. Journal of Traditional and Complementary Medicine 5 (3): 138-143. https://doi.org/10.1016/j.jtcme.2015.02.004 Downie RC, Lin M, Corsi B, Ficke A, Lillemo M et al. (2021). Septoria nodorum blotch of wheat: disease management and resistance breeding in the face of shifting disease dynamics and a changing environment.  Phytopathology  111 (6): 906-920. https://doi.org/10.1094/PHYTO-07-20-0280-RVW Doyle JJ, Doyle JL (1990). Isolation of plant DNA from fresh tissue. Focus 12: 13-15. Elshafei AA, El-Orabey WM, Fathallah FB, Esmail RM, Abou-Zeid MA (2021). Phenotyping and validation of molecular markers associated with rust resistance genes in wheat cultivars in Egypt. Molecular Biology Reports 49: 1903-1915. https://doi. org/10.1007/s11033-021-07002-8 Tabib GSM, Faris JD, Friesen TL, Visser RG, van der Lee TA et al. (2012). New broad-spectrum resistance to Septoria tritici blotch derived from synthetic hexaploid wheat.  Theoretical and Appllied Genetics 124: 125-142. https://doi. org/10.1007/s00122-011-1692-7 Tabib GSM, Robert O, Laurent V, Lonnet P, Margalé E et al. (2011). Genetic analysis of resistance to septoria tritici blotch in the French winter wheat cultivars Balance and Apache. Theoretical and Appllied Genetics 123: 741-754. https://doi.org/10.1007/ s00122-011-1623-7 Goodwin SB (2007). Back to basics and beyond: increasing the level of resistance to Septoria tritici blotch in wheat. Australian Plant Pathology 36: 532-538. https://doi.org/10.1071/AP07068 Gökgöl M (1939). Turkish Wheats, Vol. II. Ministry of Agriculture, Yeşilkoy Seed Breeding Institute Publications No. 14, Tan Press, İstanbul, Türkiye (in Turkish). Hafeez AN, Chartrain L, Cong F, Cambon F, Clarke M et al. (2023). Septoria tritici blotch resistance gene Stb15 encodes a lectin receptor-like kinase.  bioRxiv 557217. https://doi. org/10.1101/2023.09.11.557217 He S, Krainer KMC (2020). Pandemics of people and plants: which is the greater threat to food security?. Molecular plant 13: 933- 934. https://doi.org/10.1016%2Fj.molp.2020.06.007 Imam J, Alam S, Mandal NP, Variar M, Shukla P (2014). Molecular screening for identification of blast resistance genes in North East and Eastern Indian rice germplasm (Oryza sativa L.) with PCR based makers. Euphytica 196: 199-211. https://doi. org/10.1007/s10681-013-1024-x Jing HC, Lovell D, Gutteridge R, Jenk D, Kornyukhin D et al. (2008). Phenotypic and genetic analysis of the Triticum monococcum–Mycosphaerella graminicola interaction.  New Phytologist 179 (4): 1121-1132. https://doi.org/10.1111/j.1469- 8137.2008.02526.x Kanwal I, Iffat A, Shaukat MB, Shafique T, Majeed Y et al. (2024). Insights into Fusarium wilt of tomato (Fusarium oxysporum f. sp. lycopersici) and its management strategies.  Journal of Agriculture and Biology  2: 31-42. https://doi.org/10.55627/ agribiol.002.01.0837 Karagöz H, Kucukozdemır U, Dumlu B, Yalcın Z (2019). Determination of yield, quality and winter hardiness characteristics of some triticale (xTriticosecale Wittmack) genotypes in Pasinler and Erzincan locations. Ekin Journal of Crop Breeding and Genetics 5 (2): 74-83. Khalid A, Hameed A, Tahir MF (2023). Wheat quality: A review on chemical composition, nutritional attributes, grain anatomy, types, classification, and function of seed storage proteins in bread making quality.  Frontiers in Nutrition  10: 1053196. https://doi.org/10.3389/fnut.2023.1053196 Khan MK, Pandey A, Choudhary S, Hakki EE, Akkaya MS et al. (2014). From RFLP to DArT: molecular tools for wheat (Triticum spp.) diversity analysis.  Genetic Resources and Crop Evolution 61: 1001-1032. https://doi.org/10.1007/s10722-014-0114-5v Luo K, He D, Guo J, Li G, Li B et al. (2023). Molecular advances in breeding for durable resistance against pests and diseases in wheat: Opportunities and challenges.  Agronomy 13 (3): 628. https://doi.org/10.3390/agronomy13030628 Mahboubi M, Talebi R, Sarbarzeh MA, Naji AM, Mehrabi R (2020). Resistance and virulence variability in wheat–Zymoseptoria tritici interactions. Crop and Pasture Science 71 (7): 645-652. https://doi.org/10.1071/CP20126 McCartney HA, Foster SJ, Fraaije BA, Ward E (2003). Molecular diagnostics for fungal plant pathogens. Pest Management Sciences 59: 129-142. https://doi.org/10.1002/ps.575 Mekonnen T, Haileselassie T, Kaul T Sharma M, Bekele G et al. (2019). Molecular screening of Zymoseptoria tritici resistance genes in wheat (Triticum aestivum L.) using tightly linked simple sequence repeat markers. European Journal of Plant Pathology 155: 593- 614. https://doi.org/10.1007/s10658-019-01795-y Morgounov A, Keser M, Kan M, Küçükçongar M, Özdemiet F et al. (2016). Wheat landraces currently grown in Turkey: distribution, diversity, and use.  Crop Science  56 (6): 3112- 3124. https://doi.org/10.2135/cropsci2016.03.0192 Naqvi SAH, Farhan M, Ahmad M, Kiran R, Fatima N et al. (2024). Deciphering fungicide resistance in Phytophthora: mechanisms, prevalence, and sustainable management approaches.  World Journal of Microbiology and Biotechnology 40: 1-17. https:// doi.org/10.1007/s11274-024-04108-6 https://doi.org/10.1111/j.1365-3059.2005.01164.x https://doi.org/10.1111/j.1365-3059.2005.01164.x https://doi.org/10.1111/j.1365-3059.2008.02013.x https://doi.org/10.1111/j.1365-3059.2008.02013.x https://doi.org/10.1007/s10658-022-02486-x https://doi.org/10.1007/s10658-022-02486-x https://doi.org/10.1016/j.jtcme.2015.02.004 https://doi.org/10.1094/PHYTO-07-20-0280-RVW https://doi.org/10.1007/s11033-021-07002-8 https://doi.org/10.1007/s11033-021-07002-8 https://doi.org/10.1007/s00122-011-1692-7 https://doi.org/10.1007/s00122-011-1692-7 https://doi.org/10.1007/s00122-011-1623-7 https://doi.org/10.1007/s00122-011-1623-7 https://doi.org/10.1071/AP07068 https://doi.org/10.1101/2023.09.11.557217 https://doi.org/10.1101/2023.09.11.557217 https://doi.org/10.1016%2Fj.molp.2020.06.007 https://doi.org/10.1007/s10681-013-1024-x https://doi.org/10.1007/s10681-013-1024-x https://doi.org/10.1111/j.1469-8137.2008.02526.x https://doi.org/10.1111/j.1469-8137.2008.02526.x https://doi.org/10.55627/agribiol.002.01.0837 https://doi.org/10.55627/agribiol.002.01.0837 https://doi.org/10.3389/fnut.2023.1053196 https://doi.org/10.1007/s10722-014-0114-5v https://doi.org/10.3390/agronomy13030628 https://doi.org/10.1071/CP20126 https://doi.org/10.1002/ps.575 https://doi.org/10.1007/s10658-019-01795-y https://doi.org/10.2135/cropsci2016.03.0192 https://doi.org/10.1007/s11274-024-04108-6 https://doi.org/10.1007/s11274-024-04108-6 ALI et al. / Turk J Agric For 109 Narayanswami B, Tomar BS, Akhtar J, Behera TK, Ellur RK et al. (2023). Genetic analysis and identification of SSR marker linked to Phomopsis blight resistance in eggplant (Solanum melongena L.).  Plant Breeding 142 (5): 700-710. https://doi. org/10.1111/pbr.13133 Narvaez I, Caldwell R (1957). Inheritance of resistance to leaf blotch of wheat caused by Septoria tritici. Phytopathology 47: 529-530. Ölmez F, Turgay EB, Mustafa Z, Büyük O, Kaymak S (2023). Screening the Zymoseptoria tritici population in Turkey for resistance to azole and strobilurin fungicides. Journal of Plant Disease and Protection  130 (5): 991-998. https://doi.org/10.1007/s41348- 023-00761-5 Özberk F, Özberk İ (2024). Status of Durum Wheat (T. durum Desf.) Genetic Resources in the Southeastern Anatolia; from Past to Present. Ekin Journal of Crop Breeding and Genetics 10 (1): 1-10. Özkan K, Hülya GÜL (2024). Some Physical and Physicochemical Characteristics of Local Karakılçık Wheat Varieties Grown in Different Provinces of Türkiye. Kahramanmaraş Sütçü İmam University Agriculture and Nature Magazine 27 (3): 674-684. https://doi.org/10.18016/ksutarimdoga.vi.1317966 Rajpoot P, Tripathi MK, Tiwari S, Bimal SS, Tripathi N et al. (2023). Characterization of pearl millet [Pennisetum glaucum (l.) R br.] genotypes against blast disease employing disease scoring and gene specific SSR markers. Scientist 3: 16-30. https://doi. org/10.5281/zenodo.7697622 Raman R, Milgate AW, Imtiaz M, Tan MK, Raman H et al. (2009). Molecular mapping and physical location of a major gene conferring seedling resistance to Septoria tritici blotch in wheat.  Molecular Breeding  24: 153-164. https://doi. org/10.1007/s11032-009-9280-0 Rehman AU, Rauf A, Ali A, Taimoor SM, Naqvi SAH et al. (2023). First report of Fusarium equiseti causing leaf spots of Bitter gourd (Momordica charantia) in Pakistan. Plant Disease 107: 584. https://doi.org/10.1094/PDIS-04-22-0786-PDN Simón MR, Cordo CA, Castillo NS, Struik PC, Börner A (2012). Population Structure of Mycosphaerella graminicola and Location of Genes for Resistance to the Pathogen: Recent Advances in Argentina. International Journal of Agronomy 1-7. https://doi.org/10.1155/2012/680275 Singh AK, Singh PK, Arya M, Singh NK, Singh US (2015). Molecular screening of blast resistance genes in rice using SSR markers. Journal of Plant Pathology 31 (1): 12-24. https://doi. org/10.5423%2FPPJ.OA.06.2014.0054 Sinha D, Maurya AK, Abdi G Majeed M, Agarwal R et al. (2023). Integrated genomic selection for accelerating breeding programs of climate-smart cereals. Genes 14 (7): 1484. https:// doi.org/10.3390/genes14071484 Torriani SF, Brunner PC, McDonald BA, Sierotzki H (2009). QoI resistance emerged independently at least 4 times in European populations of Mycosphaerella graminicola. Pest Management Science: formerly Pesticide Science 65 (2): 155-162. https://doi. org/10.1002/ps.1662 Tidd H, Rudd JJ, Ray RV, Bryant R, Kanyuka K (2023). A large bioassay identifies Stb resistance genes that provide broad resistance against Septoria tritici blotch disease in the UK.  Frontier in Plant Sciences  13: 1070986. https://doi. org/10.3389/fpls.2022.1070986 Ünal G, Kayim M, Ay T, Yones AM (2017). Evaluation of disease intensity and molecular identification of Zymoseptoria tritici causing Septoria leaf blotch on wheat in the Eastern Mediterranean Region of Turkey. Turkish Journal of Agriculture and Forstry 41 (6): 405-413. https://doi.org/10.3906/tar-1703-74 Yadav J, Jasrotia P, Jaglan MS, Sareen S, Kashyap PL et al. (2024). Unravelling the novel genetic diversity and marker-trait associations of corn leaf aphid resistance in wheat using microsatellite markers. PlosOne 19 (2): e0289527. https://doi. org/10.1371/journal.pone.0289527 Yang N, McDonald MC, Solomon PS, Milgate AW (2018). Genetic mapping of Stb19, a new resistance gene to Zymoseptoria tritici in wheat.  Theoretical and Applied Genetics 131: 2765-2773. https://doi.org/10.1007/s00122-018-3189-0 Özberk F, Karagöz A, Özberk İ, Ayhan ATLI (2016). Buğday genetik kaynaklarından yerel ve kültür çeşitlerine; Türkiye’de buğday ve ekmek. Tarla Bitk Mer Araştırma Enst Dergisi 25 (2): 218- 233 (in Turkish). Özbek K, Keskin CN, Zencirci N (2024). Advances in Wheat Breeding: Towards Climate Resilience and Nutrient Security. In: Zencirci N, Altay F,  Baloch FS, Nadeem MA, Ludidi N (editors). Wheat Genetic Resources. Singapore: Springer Nature Singapore. pp. 525-554. https://doi.org/10.1007/978- 981-99-9478-6 Yalinkiliç NA, Başbağ S, Altaf MT, Ali A, Nadeem MA et al. (2024). Applicability of SCoT markers in unraveling genetic variation and population structure among sugar beet (Beta vulgaris L.) germplasm.  Molecular Biology Reports  51: 584. https://doi. org/10.1007/s11033-024-09526-1 Zenda T, Liu S, Dong A, Duan H (2021). Advances in cereal crop genomics for resilience under climate change. Life 11 (6): 502. https://doi.org/10.3390/life11060502. https://doi.org/10.1111/pbr.13133 https://doi.org/10.1111/pbr.13133 https://doi.org/10.1007/s41348-023-00761-5 https://doi.org/10.1007/s41348-023-00761-5 https://doi.org/10.18016/ksutarimdoga.vi.1317966 https://doi.org/10.5281/zenodo.7697622 https://doi.org/10.5281/zenodo.7697622 https://doi.org/10.1007/s11032-009-9280-0 https://doi.org/10.1007/s11032-009-9280-0 https://doi.org/10.1094/PDIS-04-22-0786-PDN https://doi.org/10.1155/2012/680275 https://doi.org/10.5423%2FPPJ.OA.06.2014.0054 https://doi.org/10.5423%2FPPJ.OA.06.2014.0054 https://doi.org/10.3390/genes14071484 https://doi.org/10.3390/genes14071484 https://doi.org/10.1002/ps.1662 https://doi.org/10.1002/ps.1662 https://doi.org/10.3389/fpls.2022.1070986 https://doi.org/10.3389/fpls.2022.1070986 https://doi.org/10.3906/tar-1703-74 https://doi.org/10.1371/journal.pone.0289527 https://doi.org/10.1371/journal.pone.0289527 https://doi.org/10.1007/s00122-018-3189-0 https://link.springer.com/book/10.1007/978-981-99-9478-6#author-1-0 https://link.springer.com/book/10.1007/978-981-99-9478-6#author-1-1 https://doi.org/10.1007/978-981-99-9478-6 https://doi.org/10.1007/978-981-99-9478-6 https://doi.org/10.1007/s11033-024-09526-1 https://doi.org/10.1007/s11033-024-09526-1 https://doi.org/10.3390/life11060502 Molecular screening of septoria-resistant genes in historical Turkish bread wheat germplasm using the validated gene specific SSR markers Recommended Citation Molecular screening of septoria-resistant genes in historical Turkish bread wheat germplasm using the validated gene specific SSR markers Authors tmp.1739709363.pdf.UBz3t