PLOS ONE
RESEARCH ARTICLE
Transgenic expression of Arabidopsis
ELONGATION FACTOR-TU RECEPTOR (AtEFR)
gene in banana enhances resistance against
Xanthomonas campestris pv. musacearum
Mark Adero1,2, Jaindra Nath Tripathi 1
ID *, Richard Oduor2, Cyril Zipfel 3,4
ID ,
Leena Tripathi 1
ID *
a1111111111 1 International Institute of Tropical Agriculture (IITA), Nairobi, Kenya, 2 Kenyatta University, Nairobi, Kenya,
3 Department of Plant and Microbial Biology, Zurich-Basel Plant Science Center, University of Zurich, Zurich,
a1111111111
Switzerland, 4 The Sainsbury Laboratory, University of East Anglia, Norwich Research Park, Norwich, United
a1111111111 Kingdom
a1111111111
a1111111111 * j.tripathi@cgiar.org (JNT); l.tripathi@cgiar.org (LT)
Abstract
OPEN ACCESS Banana Xanthomonas wilt (BXW) caused by Xanthomonas campestris pv. musacearum
Citation: Adero M, Tripathi JN, Oduor R, Zipfel C, (Xcm) is a severe bacterial disease affecting banana production in East and Central Africa,
Tripathi L (2023) Transgenic expression of
where banana is cultivated as a staple crop. Classical breeding of banana is challenging
Arabidopsis ELONGATION FACTOR-TU RECEPTOR
(AtEFR) gene in banana enhances resistance because the crop is clonally propagated and has limited genetic diversity. Thus, genetic
against Xanthomonas campestris pv. engineering serves as a viable alternative for banana improvement. Studies have shown
musacearum. PLoS ONE 18(9): e0290884. https:// that transfer of the elongation factor Tu receptor gene (AtEFR) from Arabidopsis thaliana to
doi.org/10.1371/journal.pone.0290884
other plant species can enhance resistance against bacterial diseases. However, AtEFR
Editor: Eugenio Llorens, Universitat Jaume 1, activity in banana and its efficacy against Xcm has not been demonstrated. In this study,
SPAIN
transgenic events of banana (Musa acuminata) cultivar dwarf Cavendish expressing the
Received: June 12, 2023 AtEFR gene were generated and evaluated for resistance against Xcm under greenhouse
Accepted: August 18, 2023 conditions. The transgenic banana events were responsive to the EF-Tu-derived elf18 pep-
Published: September 1, 2023 tide and exhibited enhanced resistance to BXW disease compared to non-transgenic control
plants. This study suggests that the functionality of AtEFR is retained in banana with the
Peer Review History: PLOS recognizes the
benefits of transparency in the peer review potential of enhancing resistance to BXW under field conditions.
process; therefore, we enable the publication of
all of the content of peer review and author
responses alongside final, published articles. The
editorial history of this article is available here:
https://doi.org/10.1371/journal.pone.0290884
Copyright: © 2023 Adero et al. This is an open Introduction
access article distributed under the terms of the
Banana (Musa spp.) is a staple food for about 400 million people, a crucial food security crop,
Creative Commons Attribution License, which
and a source of income, especially in low-income countries [1]. The Great Lakes region,
permits unrestricted use, distribution, and
reproduction in any medium, provided the original including Burundi, Rwanda, Uganda, Kenya, Tanzania, and the Democratic Republic of
author and source are credited. Congo, is the largest banana producer in Africa. Bananas in this region are produced by small
holder farmer mainly for local consumption. The daily consumption is estimated to be 147
Data Availability Statement: All relevant data are
within the paper and its Supporting Information kcal daily per person, which is 15 times higher than the global average and six times higher
files. than Africa’s average [2]. Unfortunately, banana production in this region is hindered by
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 1 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
Funding: This study was supported by the 2 Blades banana Xanthomonas wilt (BXW), a systemic bacterial disease caused by Xanthomonas cam-
Foundation, the Gatsby Charitable Foundation, and pestris pv.musacearum (Xcm). The disease is the biggest threat to banana production in the
the United States Agency for International
region, with economic losses estimated to be US$ 2–8 billion over a decade [3]. Symptoms of
Development (USAID). The funders had no role in
BXW disease manifest as premature ripening and rotting of fruits, shriveling of inflorescence,
study design, data collection and analysis, decision
to publish, or preparation of the manuscript. wilting, and yellowing of leaves leading to the death of the infected plant. The bacterial patho-
gen spread by insect vectors, use of contaminated tools and infected planting materials. The
Competing interests: The authors have declared
disease is managed through cultural practices, including removing male buds to eliminate
that no competing interests exist.
insect vectors, removing diseased plants, use of clean pathogen-free planting material, and dis-
infecting farm tools [4]. Conventional breeding of clonally propagated crops like banana is
limited by the lack of genetic diversity and availability of important traits in the gene pool [5].
All cultivated banana varieties are susceptible to BXW disease; however, resistance has been
observed in one of the wild banana progenitorMusa balbisiana belonging to the BB genome
[3, 6]. Unfortunately, the B genome is laced with banana streak virus (BSV) sequences; during
hybridization, recombination of integrated virus sequences sometimes results in BSV infection
[7]. This has limited the use ofM. balbisiana in conventional breeding. Notably, tolerance to
Xcm has also been reported inMusa acuminata subsp. Zebrina belonging to AA genome, sug-
gesting that tolerant traits could be present in existing banana germplasm [8]. Further, the
molecular basis of disease resistance in banana progenitorMusa balbisiana against Xcm was
investigated [6]. Comparative transcriptome analysis of BXW-resistant genotypeMusa balbisi-
ana and BXW-susceptible banana cultivar ‘Pisang Awak’ challenged with Xcm showed differ-
entially expressed genes associated with response to biotic stress, which were mapped to the
biotic stress pathways to identify genes associated with defense mechanisms. This study identi-
fied several genes involved in the activation of pathogen-associated molecular patterns
(PAMP)-triggered basal defense and disease resistance (R) protein-mediated defense inMusa
balbisiana as an early response to Xcm infection. TheseMusa defense genes can be overex-
pressed in the BXW-susceptible cultivars using biotechnological tools such as transgenic or
genome editing for develing resistance against Xcm.
One of the approaches to enhancing plant disease resistance is by boosting their immune
system [9]. Plants have evolved two main mechanisms for evading pathogens. One involves
recognizing potential phytopathogens before they establish and is achieved through pattern
recognition receptors (PRRs), which recognize conserved pathogen-associated molecular pat-
terns (PAMPs), resulting in PAMP-triggered immunity (PTI). In addition, plants utilize resis-
tance (R) proteins, that are mainly nucleotide-binding site leucine-rich repeat receptors
(NLRs) that sense specific pathogen effectors leading to effector-triggered immunity (ETI)
[10]. Resistance through ETI is typically race-specific and limited to plant varieties with a par-
ticular R-gene and specific pathogens with corresponding virulence effector. Meanwhile,
PAMPs are conserved among a wide range of microbes; thus, plants tend to exhibit broad-
spectrum resistance to pathogens. As PAMPs are essential for microbial survival, their evolu-
tion is slower than virulence effectors [11]. Therefore, PTI has the potential of conferring dura-
ble and broad-spectrum disease resistance compared to ETI.
Several plant PRRs have been identified and characterized. The best studied PRR is FLA-
GELLIN SENSING 2 (FLS2), a leucine-rich repeat receptor kinase (LRR-RK), which recog-
nizes a N-terminal 22-amino acid motif, flg22, of bacterial flagellin [12]. Another PRR, related
to FLS2, that has been extensively studied is the Brassicaceae-specific ELONGATION FAC-
TOR TU RECEPTOR (EFR), which recognizes the N-terminal acetylated motif elf18 of bacte-
rial elongation factor thermal unstable (EF-Tu), thereby activating plant defense response
against many bacteria [13]. EF-Tu is the most copious protein in bacteria and plays an indis-
pensable role in protein synthesis by catalyzing the binding of aminoacyl transfer RNA to the
ribosome [14].
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 2 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
EFR plays a significant role in plant response to bacterial infection, thus, it has been widely
applied to engineer crops against diverse bacterial diseases. Heterologous expression of Arabi-
dopsis thaliana EFR (AtEFR) in Nicotiana benthamiana and Solanum lycopersicum (tomato)
conferred responsiveness to elf18 peptide from diverse bacterial genera, including Agrobacter-
ium, Xanthomonas, Pseudomonas, and Ralstonia. Furthermore, the N. benthamiana and
tomato transgenic events exhibited enhanced resistance to different genera of bacterial patho-
gens [15]. So far, transgenic expression of AtEFR has effectively enhanced the resistance of
major crops against various bacterial pathogens, including wheat (Triticum aestivum) against
Pseudomonas syringae pv. oryzae [16], rice (Oryza sativa) against Xanthomonas oryzae pv. ory-
zae [17], potato (S. tuberosum) against Ralstonia solanacearum [18], apple (Malus malus)
against Erwinia amylovora [19], and sweet orange (Citrus sinensis) against Xanthomonas citri
and Xylella fastidiosa [20].
Previously, the transgenic banana expressing sweet pepper hypersensitive response-assist-
ing protein (Hrap) or plant ferredoxin-like protein (Pflp) genes were developed and tested [21,
22]. These transgenic bananas showed enhanced resistance to BXW through successive crop
cycles and agronomic performance comparable to non-transgenic bananas under field trials in
Uganda [23]. Transgenic bananas with resistance against BXW were also developed by trans-
forming embryogenic cell suspensions of banana cultivar ‘Sukali Ndiizi’ with Xa21 gene [24].
The Xa21 transgenic banana events exhibited enhanced resistance against BXW under green-
house conditions. Transgenic banana expressing rice NH1 gene also showed enhanced resis-
tance against BXW disease [25]. The bacterial pathogen can evolve resistance mechanisms to
overcome the defense conferred by most single genes or single mode of action. To avoid or
minimize the chances of breaking down of disease resistance, there is a need to stack several
transgenes with different mode of actions in the banana event for enhanced and durable resis-
tance to BXW disease.
In this study, transgenic banana cultivar dwarf Cavendish (Musa spp., AAA genomic
group) constitutively expressing AtEFR under the control of the constitutive CaMV35S pro-
moter were developed and evaluated against Xcm under controlled greenhouse conditions.
The transgenic banana events showed enhanced resistance to BXW disease, as exhibited by sig-
nificantly reduced wilting incidences and a lower bacterial population compared to the non-
transgenic control plants. Assessment of defense-related gene expression and oxidative burst
assay further revealed that the transgenic events gained responsiveness to elf18, indicating that
AtEFR activity is retained after its transfer and integration into the banana genome.
Materials and methods
Plant material
Embryogenic cell suspensions (ECS) of banana cultivar dwarf Cavendish were used for trans-
formation. The ECS were initiated from meristematic shoot tissues using the protocol
described by Tripathi et al. [26] and maintained at 28±2˚C on a rotary shaker at 95 rpm in the
dark.
Generation of transgenic plants
The plasmid construct pBIN19g-35S::AtEFR [15], harboring ELONGATION FACTOR TU
RECEPTOR gene from Arabidopsis thaliana (AtEFR) and neomycin phosphotransferase II
(nptII) gene for kanamycin selection was transformed into Agrobacterium tumefaciens strain
EHA105 by electroporation. The plasmid construct was validated through restriction enzyme
digestion and PCR analysis using AtEFR-specific primers before using it for transformation.
Banana ECSs were transformed as per the method described previously [26]. Agrobacterium
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 3 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
infected ECSs were regenerated on a selective medium supplemented with 100 mg/l kanamy-
cin following the protocol described by Tripathi et al. [26]. All regenerated putative transgenic
events were maintained and multiplied on proliferation medium at 28±2˚C for a 16-/ 8-h
light/dark photoperiod under fluorescent tube lights. The putative transgenic events were
characterized for the presence of the transgene. The transgenic shoots were transferred to the
rooting medium. The well-rooted events were transferred to soil in the greenhouse for disease
evaluation.
Molecular analysis of transgenic events
Polymerase chain reaction analysis. Genomic DNA was extracted from the putatively
transformed events using a cetyltrimethylammonium bromide (CTAB) method [27]. PCR was
performed in a 25-μL reaction volume containing 2.5 μL 10X PCR buffer, 0.3 μL dNTPs, 1μL
of 10 μM reverse and forward AtEFR primers, 2 μL genomic DNA (100ng/μL), 0.2 μL Taq
DNA polymerase (Qiagen, Germany), and 18 μL nuclease-free water. Thermocycler condi-
tions were as follows: initial denaturation at 95˚C for 5 min, followed by 35 cycles of denatur-
ation at 94˚C for 30 s, annealing at 60˚C for 30 s, and extension at 72˚C for 45 s, then final
extension at 72˚C for 7 min. Genomic DNA from non-transgenic control plant and pBIN19g-
35S::AtEFR plasmid were used as negative and positive controls, respectively. The primers [for-
ward 5’CGGGAATCTTGTAAGCCTGC 3’and reverse 5’GCACCCTTCCCTCAAACTTG 3’]
amplifying 635 base pairs (bp) region within the AtEFR gene were used for PCR analysis. The
amplified products were run on a 1% agarose gel (Duchefa, Netherlands) stained with
GelRed1 (Biotium, San Francisco, USA) and visualized under ultraviolet light.
Southern blot analysis. Southern blot analysis was performed as per the method
described by Tripathi et al. [23]. Briefly, 10 μg of genomic DNA from each sample was
restricted with BamH1 for 12 h. The DNA samples, including plasmid pBIN19g-35S::AtEFR
and genomic DNA sample from a control non-transgenic plant, were run for a 0.8% agarose
gel at 50 V. The gel stained with GelRed1 was viewed under ultraviolet light to confirm the
digestion. The restricted DNA was denatured, then blotted onto a positively charged mem-
brane (Roche Diagnostics, West Sussex, UK) and fixed using ultraviolet cross-linking. The
blots were then hybridized with a digoxigenin (DIG) PCR-labeled 635-bp AtEFR-specific
probe. Hybridization and probe detection was performed using a DIG Luminescent Detection
Kit for Nucleic Acids (Roche Diagnostics, UK) as per the manufacturer’s protocol.
Plant growth analysis
Eight PCR positive transgenic events and control plants were randomly selected for the plant
growth analysis. Three replicates of well-rooted plants for each event were transferred to soil
in small plastic cups and acclimatized for 30 days in a humidity chamber, then transferred to
bigger pots and grown in the greenhouse for 90 days at 25–30˚C. The growth parameter data,
including plant height, pseudostem girth, number of functional leaves, and length and width
of the middle leaf, were recorded from 90-day-old plants. The total leaf area was calculated
using the formula below [28].
Total leaf area = 0.8� L�W�N
In which, L = Length of the middle leaf, W = width of the middle leaf, and N = total number
of leaves in the plant.
Greenhouse evaluation of transgenic events for resistance to BXW disease
Three replicates of each transgenic event and non-transgenic control were evaluated for resis-
tance against Xcm under greenhouse conditions. A total of 31 transgenic events were used for
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 4 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
the disease assay. The transgenic events and non-transgenic control plants were arranged in a
completely randomized design. The culture of Xcm (Ugandan isolate, sublineage 2) that met
the four Koch postulates were cultured in YPGA medium (0.5% yeast extract, 0.5% peptone,
1% glucose, and 0.8% micro agar) for 48 h at 28˚C. A single colony was aseptically isolated and
further cultured for 48 h in 50 mL of YPG medium at 28˚C in an incubator shaker (200 rpm).
Subsequently, the liquid culture was centrifuged at 4000 rpm for 15 min and the pellet resus-
pended in sterile distilled water. The suspension concentration was adjusted to OD600nm of 1
using sterile distilled water. The second open functional leaf of 90-day-old potted plant was
inoculated with 100 μL of the bacterial suspension using an insulin syringe. The plants were
maintained in the greenhouse under observation, and symptoms were recorded as they
occurred for 60 days post-inoculation (dpi). The data collected included number of days for
appearance of the first symptom, number of days for complete wilting, disease severity, and
the number of leaves showing symptoms at 60 dpi. The data was used to calculate percent
resistance compared to control non-transgenic plants using the formula below [27]:
Resistance (%) = (Reduction in wilting of transgenic event/number of leaves wilted in the
control plant)�100
In which, reduction in wilting was the total number of leaves minus the number of leaves
wilted.
Disease severity was rated on a scale of 0–5 (0- no signs of the disease, 1- a single leaf show-
ing symptom, 2-two to three leaves with symptoms, 3- four to five leaves with symptoms, 4- all
the leaves have symptoms but plant not dead, 5- complete death).
Plants were categorized as resistant if they did not show any symptom, partially resistant if
the symptoms did not spread to all the leaves, and susceptible if the symptoms spread to all the
leaves, causing complete wilting or death of the plant.
In planta bacterial population analysis
For the bacterial population study, two transgenic events (T5 and T7) that exhibited enhanced
resistance against Xcm under greenhouse conditions, along with control non-transgenic
plants, were used for this experiment. Three replicates of 90-day-old potted plants were inocu-
lated with Xcm culture as described previously [21]. Leaf-mid rib sections (1 cm) of the inocu-
lated leaves were collected at 0, 3, 6, 9, 12, and 15 pdi. The samples were ground in 15-mL
falcon tubes after adding 2 mL of YPG medium and incubated in an incubator shaker (200
rpm) for 1 h at 28˚C. Five serial dilutions of the sample suspensions were spread on YPGA
medium supplemented with 50 mg/L cephalexin to select for Xcm and cultured at 28˚C for 48
h. Samples from each line were cultured in triplicate for every time point. The bacterial popu-
lation was determined by counting colonies for each dilution and described using growth
curve analysis.
Transgene expression analysis
To determine the relative gene expression of various transgenic events compared to control
non-transgenic plant, total RNA was extracted from the leaves of two-week-old shoots using
RNeasy plant mini kit (Qiagen, Germany) according to the manufacturer’s instructions. The
RNA quality and concentration were determined using NanoDrop 2000 (Thermo Fisher Sci-
entific). And 1 μg of the total RNA was reverse transcribed into cDNA using Luna script RT
Supermix (New England Biolabs) as per the manufacturer’s protocol. The cDNA templates
were then used for PCR amplification of the AtEFR gene transcript. The PCR was performed
in a 25-μL reaction volume containing 2.5 μL10X PCR buffer, 0.3 μL dNTPs, 1μL of 10 μM
reverse and forward AtEFR primers (S1 Table), 2 μL cDNA, 0.2 μL Taq DNA polymerase, and
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 5 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
18 μL nuclease-free water under the following conditions: initial denaturation at 95˚C for 5
min followed by 35 cycles of denaturation at 94˚C for 30 sec, annealing at 55˚C for 30 sec, and
extension at 72˚C for 1 min, then final extension at 72˚C for 7 min.Musa 25s ribosomal tran-
script was used as an internal control to check the quality of the cDNA. qRT-PCR was per-
formed using Luna1Universal qPCR Master Mix (New England Biolabs) on a Quanta Studio
Real-Time PCR System (Applied Biosystems, Foster City, CA) under the following conditions:
initial denaturation at 95˚C for 5 min followed by 40 cycles of denaturation at 94˚C for 30 s,
annealing at 60˚C for 30 s, and extension at 72˚C for 1 min. The reaction mixture was in a
20 μl reaction volume consisting of 10 μl Luna1Universal qPCR Master Mix, 0.2 μl forward
and reverse primers (S1 Table), 5 μl cDNA, and 4.6 μl nuclease-free water. Each sample con-
sisted of three biological replicates.Musa 25s ribosomal transcript served as an internal control
for the normalization of gene expression. The relative levels of the AtEFR gene were analysed
using Livak & Schmittgen method [29].
Expression analysis of defense-related genes
The leaves of two-week-old shoots were infiltrated with 250 nM elf18 peptide solution for 60,
120, and 180 min. Total RNA was extracted and qRT-PCR was performed as described in the
above section to check the relative expression of defense-related genes (MaWRKY-22 like,
MaPR1-like,MaPR2-like,MaPR3-like,MaPR4-like, andMaPR5-like) in the transgenic events
compared to control non-transgenic events. qRT-PCR was performed with initial denatur-
ation at 95˚C for 10 min followed by 40 cycles of denaturation at 95˚C for 15 s, annealing at
60˚C for 30 s, and extension at 72˚C for 1 min. Each sample consisted of three biological repli-
cates.Musa 25s ribosomal transcript was used as an internal control for the normalization of
gene expression. The primers used are presented in S1 Table.
ROS production assay
Hydrogen peroxide production in the transgenic events after elf18 infiltration was determined
through histochemical staining assay using DAB (3,3’-diaminobenzidine) solution [30].
Briefly, freshly opened leaves of 14-day-old in vitro plantlets were infiltrated with 100 μL of
250 nM elf18 peptide dissolved in sterile distilled water. The leaves were left to incubate for 2
h, after which they were harvested and submerged in DAB solution in 15-mL falcon tubes
wrapped with aluminum foil. The samples were incubated in DAB solution for 5 h on a shaker
(70 rpm) at room temperature. Following incubation, DAB solution was removed, and sam-
ples were bleached with a solution (ethanol: acetic acid: glycerol = 3:1:1) for 15 min in the
water bath at 95˚C to remove chlorophyll. The bleaching solution was refreshed thrice, and the
samples were further incubated for 30 min at room temperature. The samples were then
removed from the bleaching solution, dried on paper towels, and photographed using
SMZ1500 stereomicroscope (Carlsbad, CA, USA) attached with high zoom Nikon camera.
The photomicrographs were analyzed using image J software (National Institutes of Health,
USA) to compare the browning intensities.
Statistical analysis
Data analysis was performed using Minitab Statistical Software, version 17 (Pennsylvania,
USA). Differences in disease resistance and plant growth characteristics between various trans-
genic events and non-transgenic control plants were analyzed using one-way analysis of vari-
ance (ANOVA) and means separated by Fisher’sHSD test. Statistical significance was
determined at p�0.05.
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 6 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
Results
Generation of transgenic events
Embryogenic cell suspensions (ECSs) of banana cultivar dwarf Cavendish were co-cultivated
with Agrobacterium tumefaciens strain EHA105 harboring the binary vector pBIN19g:35S::
AtEFR [15] for three days. Agrobacterium-infected ECSs turned from cream to brown color
during co-cultivation. Browning intensified when the cells were transferred to embryo devel-
opment medium (EDM) supplemented with 100 mg/L kanamycin for selecting transformed
embryogenic cells. After about 30 days of culture on the same medium, white embryos began
to appear on the surface of the dark heap of cells (Fig 1A). The white embryos increased in
number and size when the cells were transferred to fresh EDM. After 14 days of culture on
Fig 1. Generation of transgenic banana events expressing AtEFR gene. (A) Embryogenic cells in selective embryo development medium (EDM), (B)
Embryos maturing and germinating on selective embryo maturation medium (EMM), (C) Germination of embryos in selective embryo germination
medium (EGM), (D) Complete plantlets on selective proliferation medium (PM).
https://doi.org/10.1371/journal.pone.0290884.g001
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 7 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
selective embryo maturation medium (EMM), a few embryos germinated into plantlets, but
most continued to expand on the same medium without developing any organized structures
(Fig 1B). Most embryos germinated into complete plantlets on a selective embryo germination
medium (EGM) after 20–30 days of culture (Fig 1C). After germination, the shoots elongated
when transferred to proliferation medium (PM) supplemented with 100 mg/L kanamycin (Fig
1D). In total, 32 putative transgenic events were regenerated from three separate experiments.
Molecular characterization of transgenic events
The regenerated putative transgenic events were validated for the presence and integration of
the transgene by PCR and Southern blot analysis, respectively. The PCR analysis using AtEFR-
specific primers revealed an amplicon of the expected size (635 bp) (Fig 2A), confirming the
presence of the AtEFR gene in the transgenic events. No amplification was observed in control
non-transgenic plants. Further, 14 PCR-positive events were assessed using Southern blot
analysis to confirm transgene integration and copy number. Southern hybridization of
BamH1-digested genomic DNA using an AtEFR-specific probe confirmed the integration of
the transgene in the plant genome with different hybridization profiles, indicating random
insertion of the transgene in the genome of the tested events. The copy number of the trans-
gene incorporated in the different events ranged from at least one to multiple (Fig 2B). No
transgene integration was detected in the non-transgenic control plants.
Plant growth analysis
To assess growth parameters of the generated transgenic events, plant height, pseudostem
girth, total leaf area and number of functional leaves were evaluated in eight randomly selected
Fig 2. Molecular analysis of putatively transgenic banana events expressing AtEFR gene. A) Polymerase chain
reaction assay to confirm the presence of AtEFR gene, B) Southern blot analysis to confirm the integration of AtEFR
gene. M; molecular marker, C; Control, P; plasmid.
https://doi.org/10.1371/journal.pone.0290884.g002
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 8 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
Fig 3. Growth analysis of transgenic banana events expressing AtEFR gene compared to non-transgenic control plants. (A) Plant height, B) Pseudostem
girth, (C) Number of functional leaves, (D) Total leaf area. Data are presented as means ± standard deviation. Bars with different letters are significantly
different at p<0.05 according to Fisher’s HSD test (n = 3).
https://doi.org/10.1371/journal.pone.0290884.g003
transgenic events and non-transgenic control plants. All plants showed normal growth with
no morphological abnormalities. No significant differences (p<0.05) in plant height, pseudos-
tem girth, and total leaf area were observed between the transgenic events and the non-trans-
genic control plants (Fig 3A–3D), indicating that overexpression of the AtEFR gene in
transgenic banana did not alter plant growth.
Evaluation of transgenic banana events for resistance to banana
Xanthomonas wilt
Thirty-one transgenic events were evaluated through a greenhouse bioassay for disease resis-
tance compared to non-transgenic control plants. Significant differences were observed among
the transgenic and non-transgenic control events regarding the number of days to the appear-
ance of the first symptom and the number of days to complete wilting of plants. BXW disease
symptoms, such as necrosis and wilting of leaves, appeared in non-transgenic control plants at
16 dpi, whereas transgene-positive plants showed symptoms at only 18 to 42 dpi (Table 1).
None of the transgene-positive plants showed complete resistance to BXW disease. Even though
several transgene-positive plants showed disease symptoms, disease progression was signifi-
cantly slower than in control plants. Complete wilting was observed in control plants after an
average of 22 dpi, compared to transgene-positive plants, which started to collapse 25 dpi, with
the majority dying 30 dpi. Out of the 31 events evaluated, 18 events were found to exhibit partial
resistance (50–75%) compared to control non-transgenic plants (Table 1, Fig 4A & 4B).
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 9 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
Table 1. Greenhouse evaluation of transgenic events of banana cultivar ‘dwarf Cavendish’ expressing AtEFR gene for resistance against Xanthomonas campestris
pv. musacearum.
Line number Mean number of days for appearance of first symptoms Mean number of days for complete wilting Percent resistance Disease rating
T1 22.5±7.8bc NCW 75.4±5.4bc PR
T2 27.0±2.83b NCW 66.7±9.5b PR
T3 29.5±0.7b 42.5±6.4a 33.3±10.5a S
T4 36.0±2.83a NCW 66.7±10.5b PR
T5 20.5±2.12bc NCW 75.0±6.9bc PR
T6 42.5±2.12a NCW 58.3±7.8ab PR
T7 20±1.5bc NCW 66.7±9.5b PR
T8 18±2.1c NCW 50 ±10.5ab PR
T9 21.0±2.83bc 33.5±2.12ab 33.3±10.5a S
T10 22.0±0.7bc NCW 71.4±9.0bc PR
T11 27.0±0.0b NCW 66.7±10.5b PR
T12 28.5±14.8b 31.0±2.6abc 38.1±9.5a S
T13 18.3±1.5c 26.3±2.1bc 0a S
T14 21.0±2.8bc NCW 66.7±10.5b PR
T15 24.0±1.4bc 38.0±2.6ab 47.6±9.9ab S
T16 21.5±2.1bc 29.0±2.8bc 33.3±10.5a S
T17 20±3.1bc NCW 50±9.9ab PR
T18 21.0±2.8bc NCW 66.7±10.5b PR
T19 22.0±2.1bc NCW 66.7±10.5b PR
T20 20.5±3.5bc 33.0±2.8ab 33.3±9.5a S
T21 28.5±10.6b 43.0±14.1a 33.3±9.9a S
T22 19.0±0.0bc 25.0±2.8bc 33.3±7.5a S
T23 29.0±9.9b NCW 66.7±9.5b PR
T24 24.0±4.2bc NCW 66.7±6.5b PR
T25 23.0±0.0bc 34±2.6ab 41.7±9.0ab S
T26 28.3±2.1b NCW 66.7±10.5b PR
T27 25.5±3.1b NCW 66.7±10.5b PR
T28 21.0±1.8bc NCW 66.7±10.5b PR
T29 25.5±2.8b 35±2.0ab 33.3±9.5a S
T30 27.0±0.0b 32±2.8ab 33.3±9.5a S
T31 22.5±0.7bc NCW 66.7±10.5b PR
Control 16.3±1.2c 22.0±2.0c 0a S
Means followed by the same superscript letter in the same column are not significantly different according to Fisher HSD test at p<0.05
Data are presented as means±standard diviation (SD). NS; no symptoms
NCW; no complete wilting
S; suseptible
PR; partial resistance.
https://doi.org/10.1371/journal.pone.0290884.t001
Testing transgenic banana events for oxidative burst
To assess whether the transgenic events exhibited enhanced production of reactive oxygen spe-
cies upon pathogen infection, the leaves of transgenic event T5 and non-transgenic control
were infiltrated with either sterile water or 250 nM elf18 for 2 hpi, followed by diaminobenzi-
dine (DAB) staining to detect the accumulation of hydrogen peroxide. Positive-transgenic
plants infiltrated with elf18 exhibited more intense browning than the mock-treated control
and transgenic plants (Fig 5A & 5B) suggesting that the expression of AtEFR confers elf18 per-
ception and subsequent activation of early signaling immune outputs in the transgenic plants.
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 10 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
Fig 4. Evaluation of transgenic banana events expressing AtEFR gene and non-transgenic control for resistance to BXW disease. (A) Transgenic banana
event T7 showing partial resistance to BXW disease, (B) Non-transgenic control plants showing complete wilting due to BXW disease. Photographs were taken
at 60 days post inoculations (dpi).
https://doi.org/10.1371/journal.pone.0290884.g004
Relative expression of AtEFR gene among transgenic events
The relative expression of the AtEFR transgene was assessed through reverse-transcriptase
(RT) quantitative PCR (RT-qPCR) assays in seven transgenic events compared to non-trans-
genic control plants. The seven transgenic events were selected based on their level of disease
resistance in the glasshouse, ranging from 33% resistance in T3 event to 75% resistance in T1
and T5 event (Table 1). Variations in transcript levels were observed between the various
transgenic events tested. For example, T5 event showed the highest level of AtEFR gene
Fig 5. ROS production assay in transgenic event T5 and non-transgenic control (NC) after elf18 infiltration followed by diaminobenzidine (DAB)
staining. A) Photomicrographs showing the difference in browning intensity between the leaves of transgenic events compared to non-transgenic control
plants, (B) Graphical representation of browning intensity of non-transgenic control and transgenic leaves after elf18 infiltration followed by DAB staining.
Error bars represent the standard error of the mean of three independent biological replicates.
https://doi.org/10.1371/journal.pone.0290884.g005
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 11 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
Fig 6. Relative expression of AtEFR gene in transgenic banana events. (A) Reverse-transcriptase (RT)-PCR products
corresponding to 100 bp AtEFR gene fragment, (B) RT-PCR products corresponding toMusa 25s gene (internal control),
(C) Transcription level of AtEFR in the transgenic bananas as determined using qRT-PCR. Data shown are fold induction
relative to the non-transgenic control and were normalized against the internal control geneMusa 25s. Data presented are
mean± standard deviation (SD) of three replicate experiments. Bars with different letters are significantly different at
p<0.05 according to Fisher’sHSD test. M; 100-base pair marker; T; Transgenic event expressing AtEFR, C; non-transgenic
control.
https://doi.org/10.1371/journal.pone.0290884.g006
expression, whereas the lowest gene expression was observed in T3 event (Fig 6A–6C). No
EFR expression was detected in non-transgenic control plants.
Relative expression of defense-related genes in transgenic banana events
The transgenic T5 event with 75% resistance was infiltrated with 250 nM elf18, and the relative
expression of six selected defense marker genes (MaWRKY-22 like,MaPR1-like,MaPR2-like,
MaPR3-like,MaPR4-like, andMaPR5-like) was evaluated at 1, 2, and 3 h time points, relative
to the water-treated replicates. Among the tested defense-related genes,MaWRKY-22-like,
MaPR1-like andMaPR3-like were significantly upregulated in AtEFR transgene-positive plants
relative to non-transgenic control plants.MaWRKY-22-like was highly expressed mainly at 1h
post-infiltration (hpi), after which its expression reduced significantly. At 3 hpi, its expression
was not substantially different from that of the non-transgenic control. Similarly,MaPR3-like
was upregulated at all the time points, but significantly at 1 hpi. Meanwhile, the expression of
MaPR1-like andMaPR2-like was significantly higher at 3 hpi. Notably, no significant increase
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 12 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
in the expression ofMaPR4-like andMaPR5-like was observed at all time points, compared
with the non-transgenic control (Fig 7A–7C).
Bacterial population analysis of transgenic banana events
In planta bacterial population analysis was performed with two transgene-positive plants (T5
and T7) and non-transgenic control plants to determine differences in the Xcm growth rate
post inoculation. Samples were collected from each plant at specific time points following
inoculation with Xcm and cultured on a YPGA medium to examine the bacterial population.
No significant difference in bacterial titers were observed between the control and transgenic
plants up to 3 dpi (Fig 8A). However, a reduction in bacterial titers was observed in transgene-
positive plants compared to non-transgenic control at 6, 9, 12, and 15 dpi (Fig 8A). Also, sig-
nificant differences in the bacterial population were observed between the two transgenic
events assayed. Transgenic event T7 exhibited a significantly lower level of bacterial population
compared to event T5 at 15 dpi (Fig 8B).
Discussion
BXW disease continues to be the primary threat to banana production in the Great Lakes
region of East Africa since its first report in Ethiopia. Considering that most bananas grown in
Fig 7. Relative expression of defense related genes in transgenic bananas expressing AtEFR upon activation with elf18 peptide. Expression profile of
defense-related genes induced at (A) 1 h post inoculation (hpi), (B) 2 hpi, and (C) 3 hpi following infiltration with 250 nM elf18 peptide in transgenic line T5
and non-transgenic control as revealed by qRT-PCR. Results are presented as fold induction relative to water treatment and normalized to internal control
Musa 25s gene. Data presented are mean values ± standard deviation (SD) from three replicate experiments. Bars with different letters are significantly different
at p<0.05 according to Fisher’sHSD test.
https://doi.org/10.1371/journal.pone.0290884.g007
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 13 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
Fig 8. Bacterial population analysis in two transgenic events (T5 and T7) and non-transgenic control plants post inoculation with Xanthomonas
campestris pv. musacearum (Xcm). (A) Bacterial population analysis at 0 to 15 dpi with Xcm, (B) Bacterial population at 15 dpi. Data are presented as
means ± standard deviations. Bars with different letters are significantly different at p<0.05 according to Fisher’sHSD test (n = 3).
https://doi.org/10.1371/journal.pone.0290884.g008
these regions are mainly for subsistence, the impact can be severe. Developing banana varieties
with disease resistance through conventional breeding is possible; however, the process has
many limitations [31]. For example, most breeding programs use fertile diploids to hybridize
triploid varieties or tetraploid intermediates. However, given that most cultivated varieties are
triploids with low female and male fertility levels, it is not viable to repeatedly backcross the
primary hybrid to the original variety. As such, the introgression of new traits into elite varie-
ties is not practical. Also, being a clonally propagated crop, there are limited desirable traits in
banana gene pool. In this case, there are no fertile diploids with resistance to BXW, except
Musa balbisiana, which is not preferred due to its association with banana streak virus suscep-
tibility [5].
The exploitation of natural plant defenses for crop improvement through genetic engineer-
ing is increasingly becoming an attractive option for improving clonally propagated crops like
banana. Transferring PRRs across plant species that would not naturally interbreed is relatively
a recent crop improvement approach for developing disease resistance [32]. Herein, the EFR
gene from A. thaliana (AtEFR) was overexpressed in the susceptible banana cultivar ‘dwarf
Cavendish,’ and the transgenic events were evaluated for their response against Xcm in green-
house conditions. These assays revealed that transgenic bananas expressing AtEFR exhibited
enhanced resistance against Xcm compared to non-transgenic controls.
Heterologous expression of some defense-related genes has been sometimes associated with
constitutive expression of defense-related genes, which can have adverse effects on plant
growth and development, and usually manifest as shoot and root growth inhibition, necrosis,
or both [33, 34]. Such effects directly translate to yield losses. In this study, transgenic bananas
expressing AtEFR were phenotypically similar to non-transgenic control plants, indicating no
limitation to their normal growth characteristics. This further implies that constitutive expres-
sion of AtEFR in banana is not likely to affect yield, which is consistent with results previously
reported in tomato [15, 35], rice [17, 36], potato [18], Medicago [37], apple [19] and sweet
orange [20].
Pattern recognition receptors, such as EFR, confer basal resistance against adapted and
non-adapted pathogens, and thus contribute to both basal and non-host disease resistances.
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 14 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
The resistance usually is quantitative, but in some instances, it can lead to qualitative or com-
plete resistance [38]. In this study, all the transgenic events showed quantitative resistance
manifested by delay in symptom appearance and disease progression, as well as lower disease
severity compared with the wildtype controls.
Substantial evidence shows that PRRs confer more broad-spectrum resistance to pathogens
compared to R-genes, mainly because they recognize PAMPs, which are often conserved across
a wide range of genera and play essential roles in the survival of the pathogens. PRRs are there-
fore also predicted to confer more durable resistance [32, 39]. However, in rare cases, variations
in PAMP genes have been observed in adapted plant pathogens or commensals to evade recog-
nition [40–42]. Also, some pathogens produce effectors that can suppress PTI in some plants
[40, 43], but this has not been very effective as some level of PTI is usually retained, as exempli-
fied by enhanced susceptibility to virulent pathogens in mutants of PRRs [44, 45].
EFR sense bacterial EF-Tu through recognition of the N-acetylated elf18 motif, thereby acti-
vating PTI [13]. In this study, transgenic bananas expressing AtEFR gained responsiveness to
elf18 as exhibited by ROS accumulation and upregulation of defense marker genes following
elf18 peptide infiltration. These findings indicate that AtEFR activity was retained after its
transfer to banana and that necessary downstream signaling components are conserved
between Arabidopsis and the monocotyledonous plant banana. Accordingly, we observed a
significant reduction in the bacterial population at various time points following Xcm inocula-
tion compared to control plants, indicating that the activation of early immune outputs (e.g.
ROS, defense gene expression) mediated by the recognition of Xcm EF-Tu by EFR leads to
enhanced resistance to this otherwise adapted pathogen.
Induction of pathogenesis-related (PR) genes is associated with systemic acquired resis-
tance (SAR), a form of plant defense mechanism that begins from a localized region of a plant
and spreads throughout the entire plant [46]. Induction of PR gene following elf18 treatment
has been reported in transgenic rice expressing AtEFR [36]. However, it is not clear whether
the upregulation of PR genes observed in this study is a secondary response to constitutive
expression of AtEFR in banana. Therefore, further studies should be conducted to verify these
findings.
In conclusion, this study indicates that AtEFR retains its activity in banana when ectopically
expressed and confers resistance to Xcm. This further confirms that immune signaling net-
works downstream of PRRs are conserved across various plant families and thus interfamily
transfer of PRRs can be used to engineer disease resistance. Given that the resistance observed
herein was however quantitative, future studies on banana improvement against bacterial dis-
eases should focus on combining AtEFR with other defense genes like Pflp andHrap, which
could lead to stronger and more durable resistance. The transgenic banana expressing AtEFR
gene should be further tested under fields conditions for several generations to confirm the
durable resistance.
Supporting information
S1 Table. List of primers used for qRT-PCR.
(DOCX)
S1 Raw images.
(PDF)
Author Contributions
Conceptualization: Leena Tripathi.
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 15 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
Data curation: Jaindra Nath Tripathi, Leena Tripathi.
Formal analysis: Mark Adero, Jaindra Nath Tripathi, Leena Tripathi.
Funding acquisition: Leena Tripathi.
Investigation: Mark Adero, Jaindra Nath Tripathi.
Methodology: Jaindra Nath Tripathi.
Project administration: Leena Tripathi.
Resources: Leena Tripathi.
Software: Jaindra Nath Tripathi.
Supervision: Jaindra Nath Tripathi, Richard Oduor, Leena Tripathi.
Validation: Jaindra Nath Tripathi, Leena Tripathi.
Visualization: Jaindra Nath Tripathi.
Writing – original draft: Mark Adero, Jaindra Nath Tripathi.
Writing – review & editing: Richard Oduor, Cyril Zipfel, Leena Tripathi.
References
1. Voora V, Larrea C, Bermudez S. Global Market Report: Bananas.:12.
2. Ainembabazi JH, Tripathi L, Rusike J, Abdoulaye T, Manyong V. Ex-Ante Economic Impact Assess-
ment of Genetically Modified Banana Resistant to Xanthomonas Wilt in the Great Lakes Region of
Africa. PloS One. 2015; 10(9):e0138998. https://doi.org/10.1371/journal.pone.0138998 PMID:
26414379
3. Tripathi L, Mwangi M, Abele S, Aritua V, Tushemereirwe WK, Bandyopadhyay R. Xanthomonas Wilt: A
Threat to Banana Production in East and Central Africa. Plant Dis. 2009 Apr 6; 93(5):440–51. https://
doi.org/10.1094/PDIS-93-5-0440 PMID: 30764143
4. Kikulwe EM, Kyanjo JL, Kato E, Ssali RT, Erima R, Mpiira S, et al. Management of Banana Xanthomo-
nas Wilt: Evidence from Impact of Adoption of Cultural Control Practices in Uganda. Sustainability.
2019 Jan; 11(9):2610.
5. Dale J, Paul JY, Dugdale B, Harding R. Modifying Bananas: From Transgenics to Organics? Sustain-
ability. 2017 Mar; 9(3):333.
6. Tripathi L, Tripathi JN, Shah T, Muiruri KS, Katari M. Molecular Basis of Disease Resistance in Banana
Progenitor Musa balbisiana against Xanthomonas campestris pv. musacearum. Sci Rep. 2019 May 7;
9(1):7007. https://doi.org/10.1038/s41598-019-43421-1 PMID: 31065041
7. Iskra-Caruana M line Duroy PO, Chabannes M, Muller E. The common evolutionary history of badna-
viruses and banana. Infect Genet Evol. 2014 Jan 1; 21:83–9. https://doi.org/10.1016/j.meegid.2013.10.
013 PMID: 24184704
8. Nakato GV, Christelová P, Were E, Nyine M, Coutinho TA, Doležel J, et al. Sources of resistance in
Musa to Xanthomonas campestris pv. musacearum, the causal agent of banana xanthomonas wilt.
Plant Pathol. 2019; 68(1):49–59.
9. Nicaise V. Boosting innate immunity to sustainably control diseases in crops. Curr Opin Virol. 2017 Oct
1; 26:112–9. https://doi.org/10.1016/j.coviro.2017.07.030 PMID: 28802707
10. Ngou BPM, Ding P, Jones JDG. Thirty years of resistance: Zig-zag through the plant immune system.
Plant Cell. 2022 Apr 26; 34(5):1447–78. https://doi.org/10.1093/plcell/koac041 PMID: 35167697
11. Zipfel C. Plant pattern-recognition receptors. Trends Immunol. 2014 Jul; 35(7):345–51. https://doi.org/
10.1016/j.it.2014.05.004 PMID: 24946686
12. Gómez-Gómez L, Boller T. FLS2: an LRR receptor-like kinase involved in the perception of the bacterial
elicitor flagellin in Arabidopsis. Mol Cell. 2000 Jun; 5(6):1003–11. https://doi.org/10.1016/s1097-2765
(00)80265-8 PMID: 10911994
13. Zipfel C, Kunze G, Chinchilla D, Caniard A, Jones JDG, Boller T, et al. Perception of the bacterial PAMP
EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell. 2006 May 19; 125
(4):749–60. https://doi.org/10.1016/j.cell.2006.03.037 PMID: 16713565
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 16 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
14. Sprinzl M. Elongation factor Tu: a regulatory GTPase with an integrated effector. Trends Biochem Sci.
1994 Jun 1; 19(6):245–50. https://doi.org/10.1016/0968-0004(94)90149-x PMID: 8073502
15. Lacombe S, Rougon-Cardoso A, Sherwood E, Peeters N, Dahlbeck D, van Esse HP, et al. Interfamily
transfer of a plant pattern-recognition receptor confers broad-spectrum bacterial resistance. Nat Bio-
technol. 2010 Apr; 28(4):365–9. https://doi.org/10.1038/nbt.1613 PMID: 20231819
16. Schoonbeek H jan Wang HH, Stefanato FL, Craze M, Bowden S, Wallington E, et al. Arabidopsis EF-
Tu receptor enhances bacterial disease resistance in transgenic wheat. New Phytol. 2015; 206(2):606–
13. https://doi.org/10.1111/nph.13356 PMID: 25760815
17. Lu F, Wang H, Wang S, Jiang W, Shan C, Li B, et al. Enhancement of innate immune system in mono-
cot rice by transferring the dicotyledonous elongation factor Tu receptor EFR. J Integr Plant Biol. 2015
Jul; 57(7):641–52. https://doi.org/10.1111/jipb.12306 PMID: 25358295
18. Boschi F, Schvartzman C, Murchio S, Ferreira V, Siri MI, Galván GA, et al. Enhanced Bacterial Wilt
Resistance in Potato Through Expression of Arabidopsis EFR and Introgression of Quantitative Resis-
tance from Solanum commersonii. Front Plant Sci [Internet]. 2017 [cited 2023 Jun 9];8. Available from:
https://www.frontiersin.org/articles/10.3389/fpls.2017.01642
19. Piazza S, Campa M, Pompili V, Costa LD, Salvagnin U, Nekrasov V, et al. The Arabidopsis pattern rec-
ognition receptor EFR enhances fire blight resistance in apple. bioRxiv. 2021 Jan
22;2021.01.22.427734. https://doi.org/10.1038/s41438-021-00639-3 PMID: 34465763
20. Mitre LK, Teixeira-Silva NS, Rybak K, Magalhães DM, Souza-Neto RR de, Robatzek S, et al. The Arabi-
dopsis immune receptor EFR increases resistance to the bacterial pathogens Xanthomonas and Xylella
in transgenic sweet orange. bioRxiv. 2021 Jan 22;2021.01.22.427732.
21. Tripathi L, Mwaka H, Tripathi JN, Tushemereirwe WK. Expression of sweet pepper Hrap gene in
banana enhances resistance to Xanthomonas campestris pv. musacearum. Mol Plant Pathol. 2010
Nov; 11(6):721–31. https://doi.org/10.1111/j.1364-3703.2010.00639.x PMID: 21029318
22. Namukwaya B, Tripathi L, Tripathi JN, Arinaitwe G, Mukasa SB, Tushemereirwe WK. Transgenic
banana expressing Pflp gene confers enhanced resistance to Xanthomonas wilt disease. Transgenic
Res. 2012 Aug; 21(4):855–65. https://doi.org/10.1007/s11248-011-9574-y PMID: 22101927
23. Tripathi L, Tripathi JN, Kiggundu A, Kori S, Shotkoski F, Tushemereirwe WK. Field trial of Xanthomonas
wilt disease-resistant bananas in East Africa. Nature Biotechnology 2014; 32:868–870. https://doi.org/
10.1038/nbt.3007 PMID: 25203031
24. Tripathi JN, Lorenzen J, Bahar O, Ronald P, Tripathi L. Transgenic expression of the rice Xa21 pattern-
recognition receptor in banana (Musa sp.) confers resistance to Xanthomonas campestris pv. musa-
cearum. Plant Biotechnol J. 2014 Aug; 12(6):663–73.
25. Tripathi JN. Genetic Engineering of Banana Using Nonexpressor of Pathogenesis Related Gene for
Resistance to Xanthomonas Wilt and Fusarium Wilt Diseases [Internet] [Thesis]. Kenyatta University;
2018 [cited 2023 Jul 17]. Available from: https://ir-library.ku.ac.ke/handle/123456789/19013
26. Tripathi JN, Oduor RO, Tripathi L. A High-Throughput Regeneration and Transformation Platform for
Production of Genetically Modified Banana. Front Plant Sci. 2015; 6:1025. https://doi.org/10.3389/fpls.
2015.01025 PMID: 26635849
27. Stewart VIA LE. A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other PCR
applications. Rapid CTAB DNA Isol Tech Useful RAPD Fingerprinting PCR Appl. 1993; 14(5):748–51.
28. Kumar N, Krishnamoorthy V., Nalina L., Soorianathasundharam K. A new factor for estimating total leaf
area in banana [Internet]. 2002 [cited 2020 Dec 17]. Available from: https://www.musalit.org/seeMore.
php?id=14204
29. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR
and the 2- ΔΔCT method. methods. 2001; 25(4):402–8.
30. Daudi A, O’Brien JA. Detection of Hydrogen Peroxide by DAB Staining in Arabidopsis Leaves. Bio-Pro-
toc [Internet]. 2012 [cited 2020 Dec 19]; 2(18). Available from: https://www.ncbi.nlm.nih.gov/pmc/
articles/PMC4932902/ PMID: 27390754
31. Batte M, Swennen R, Uwimana B, Akech V, Brown A, Tumuhimbise R, et al. Crossbreeding East Afri-
can Highland Bananas: Lessons Learnt Relevant to the Botany of the Crop After 21 Years of Genetic
Enhancement. Front Plant Sci [Internet]. 2019 [cited 2020 Dec 22];10. Available from: https://www.
frontiersin.org/articles/10.3389/fpls.2019.00081/full
32. Boutrot F, Zipfel C. Function, Discovery, and Exploitation of Plant Pattern Recognition Receptors for
Broad-Spectrum Disease Resistance. Annu Rev Phytopathol. 2017 Aug 4; 55:257–86. https://doi.org/
10.1146/annurev-phyto-080614-120106 PMID: 28617654
33. Gurr SJ, Rushton PJ. Engineering plants with increased disease resistance: what are we going to
express? Trends Biotechnol. 2005 Jun; 23(6):275–82. https://doi.org/10.1016/j.tibtech.2005.04.007
PMID: 15922079
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 17 / 18
PLOS ONE Overexpression of AtEFR gene in banana confers resistance to banana Xanthomonas wilt
34. Hammond-Kosack KE, Parker JE. Deciphering plant-pathogen communication: fresh perspectives for
molecular resistance breeding. Curr Opin Biotechnol. 2003 Apr; 14(2):177–93. https://doi.org/10.1016/
s0958-1669(03)00035-1 PMID: 12732319
35. Kunwar S, Iriarte F, Fan Q, Evaristo da Silva E, Ritchie L, Nguyen NS, et al. Transgenic Expression of
EFR and Bs2 Genes for Field Management of Bacterial Wilt and Bacterial Spot of Tomato. Phytopathol-
ogy®. 2018 Jun 20; 108(12):1402–11. https://doi.org/10.1094/PHYTO-12-17-0424-R PMID: 29923802
36. Schwessinger B, Bahar O, Thomas N, Holton N, Nekrasov V, Ruan D, et al. Transgenic Expression of
the Dicotyledonous Pattern Recognition Receptor EFR in Rice Leads to Ligand-Dependent Activation
of Defense Responses. PLOS Pathog. 2015 Mar 30; 11(3):e1004809. https://doi.org/10.1371/journal.
ppat.1004809 PMID: 25821973
37. Pfeilmeier S, George J, Morel A, Roy S, Smoker M, Stransfeld L, et al. Expression of the Arabidopsis
thaliana immune receptor EFR in Medicago truncatula reduces infection by a root pathogenic bacte-
rium, but not nitrogen-fixing rhizobial symbiosis. Plant Biotechnol J. 2019 Mar; 17(3):569–79. https://
doi.org/10.1111/pbi.12999 PMID: 30120864
38. Ranf S. Pattern Recognition Receptors—Versatile Genetic Tools for Engineering Broad-Spectrum Dis-
ease Resistance in Crops. Agronomy. 2018 Aug; 8(8):134.
39. van Esse HP, Reuber TL, van der Does D. Genetic modification to improve disease resistance in crops.
New Phytol. 2020; 225(1):70–86. https://doi.org/10.1111/nph.15967 PMID: 31135961
40. Buscaill P, van der Hoorn RAL. Defeated by the nines: nine extracellular strategies to avoid microbe-
associated molecular patterns recognition in plants. Plant Cell. 2021 Jul 1; 33(7):2116–30. https://doi.
org/10.1093/plcell/koab109 PMID: 33871653
41. Colaianni NR, Parys K, Lee HS, Conway JM, Kim NH, Edelbacher N, et al. A complex immune response
to flagellin epitope variation in commensal communities. Cell Host Microbe. 2021 Apr 14; 29(4):635–
649.e9. https://doi.org/10.1016/j.chom.2021.02.006 PMID: 33713602
42. Parys K, Colaianni NR, Lee HS, Hohmann U, Edelbacher N, Trgovcevic A, et al. Signatures of antago-
nistic pleiotropy in a bacterial flagellin epitope. Cell Host Microbe. 2021 Apr 14; 29(4):620–634.e9.
https://doi.org/10.1016/j.chom.2021.02.008 PMID: 33713601
43. Cui H, Xiang T, Zhou JM. Plant immunity: a lesson from pathogenic bacterial effector proteins. Cell
Microbiol. 2009 Oct; 11(10):1453–61. https://doi.org/10.1111/j.1462-5822.2009.01359.x PMID:
19622098
44. Nguyen QM, Iswanto ABB, Son GH, Kim SH. Recent Advances in Effector-Triggered Immunity in
Plants: New Pieces in the Puzzle Create a Different Paradigm. Int J Mol Sci. 2021 Jan; 22(9):4709.
https://doi.org/10.3390/ijms22094709 PMID: 33946790
45. Thordal-Christensen H. A holistic view on plant effector-triggered immunity presented as an iceberg
model. Cell Mol Life Sci. 2020; 77(20):3963–76. https://doi.org/10.1007/s00018-020-03515-w PMID:
32277261
46. Durrant WE, Dong X. Systemic acquired resistance. Annu Rev Phytopathol. 2004; 42:185–209. https://
doi.org/10.1146/annurev.phyto.42.040803.140421 PMID: 15283665
PLOS ONE | https://doi.org/10.1371/journal.pone.0290884 September 1, 2023 18 / 18