Standard Operational Procedure Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing Noviembre 2024 Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing © International Potato Center 2024 DOI: 10.4160/cip.2024.11.003 CIP publications contribute important development information to the public arena. Readers are encouraged to quote or reproduce material from them in their own publications. As copyright holder CIP requests acknowledgement and a copy of the publication where the citation or material appears. Please send a copy to the Communications Department at the address below. International Potato Center P.O. Box 1558, Lima 12, Peru cip@cgiar.org • www.cipotato.org Citation: Fuentes, S.; Gutierrez, D.; Kreuze, J. 2024. Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing. Lima, Peru: International Potato Center. 26 p. DOI: 10.4160/cip.2024.11.003 Design and Layout: Communications Department November 2024 CIP also thanks all donors and organizations that globally support its work through their contributions to the CGIAR Trust Fund: www.cgiar.org/funders © 2024. This publication is copyrighted by the International Potato Center (CIP). It is licensed for use under the Creative Commons Attribution 4.0 International License http://www.cipotato.org/ http://www.cgiar.org/funders Contents INTRODUCTION........................................................................................................................... 6 SCOPE .......................................................................................................................................... 7 SAFETY ........................................................................................................................................ 7 MATERIALS .................................................................................................................................. 8 PROCEDURE .............................................................................................................................. 11 Sample reception ............................................................................................................. 11 Sampling procedure ......................................................................................................... 11 RNA Extraction with E.Z.N.A miRNA kit – Omega Bio-Tek (modified from manufacturers’ protocol) ........................................................................................................................... 11 Small RNA Library preparation ......................................................................................... 14 Purification of siRNA library with High Pure PCR Product Purification Kit – Roche (modified from manufacturers’ protocol) ........................................................................ 20 Library Quantification ....................................................................................................... 22 Multiplex Library Mixing................................................................................................... 24 Calculating dsDNA Library Concentration (converting ng/µl to nM) ............................... 24 INTERNAL QUALITY CONTROL .................................................................................................. 25 Control sample ................................................................................................................. 25 REFERENCES .............................................................................................................................. 26 Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 5 TITLE Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing OWNER* Segundo Fuentes APPROVER* Segundo Fuentes APPROVAL DATE * November 27, 2022 LAST REVIEW DATE * May 09, 2024 REVIEW FREQUENCY* 12 - 24 Months ISSUE DATE May 09, 2024 CONTRIBUTORS Fuentes, Segundo (CIP), Kreuze, Jan (CIP), Perez, Ana (CIP) CITATION * KEYWORDS HTS, Small RNA, sRSA, plant viruses, plant viroids, sequencing DOCUMENT ID * sRSAv3 VERSION NUMBER v.3 COMPETENT PERSONNEL* Fuentes, Segundo; Perez, Ana; Amao, Melody RELATED CLAUSES RELATED DOCUMENTS Small RNA Sequencing and Assembly (sRSA): Data Management and Bioinformatic Analysis procedure CITATION OF THIS DOCUMENT * Fuentes, S.; Gutierrez, D.; Kreuze, J. 2022 Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing. © International Potato Center 2022. 23p • All fields marked with * are required Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 6 INTRODUCTION Classical virus detection technologies are based on serology and/or molecular amplification or hybridization techniques and are usually virus specific. The advance of next generation or high- throughput sequencing (HTS) technologies has enabled the development of new generic approaches for the identification of viral pathogens, with extremely high sensitivity exceeding any of the classical methods. The benefits of implementing HTS based sequencing approaches for virus detection, lye in the ability to detect all known, but also unknown new viruses in a single assay with extremely high sensitivity, thus saving time, effort and cost as compared to classical virus indexing approaches which require a combination of techniques including indicator host range ensure material can be certified virus free. The most widely used HTS approach for virus detection is small RNA sequencing and assembly and broadly consists of 4 steps: i) RNA extraction, ii) small RNA library preparation and mixing of indexed libraries, iii) sequencing of the library, iv) data management, v) bioinformatics analysis, and vi) reporting of results. This SOP describes steps i, ii, and iii and the SOP on Data Management and Bioinformatic Analysis cover steps iv to vi. There are several protocols for total RNA or small RNA extraction that can be used, the most convenient and reproducible method is microRNA kit which is used for library preparation (see Fig. 1). Sample RNA extraction Send to sequencing provider RNA large small M 80 bp 50 bp 30 bp 21 bp Mixing libraries Pooled libraries (48) Library preparation of small RNA Quantification of libraries 12 ng each library Figure 1. Procedure for sequencing small RNAs for virus detection. Leaves of in vitro plants are weighed, and small RNA extracted using a commercial kit. After small RNA isolation, libraries are prepared, mixed, and sent to a provider for sequencing. Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 7 SCOPE This procedure is applied to the sampling, RNA extraction and library preparations of plant material to be tested by small RNA sequencing and assembly (sRSA) for virus testing and represents the wet-lab and reporting part of the complete procedure of sRSA. SAFETY When working with RNA always wear gloves to minimize RNase contamination. Use only clean RNase-free disposable plastic pipette tips when using the supplied reagents. Be careful when manipulating chloroform, isopropanol (2-propanol) since it causes respiratory tract, eye, and skin irritation. May be harmful if swallowed. Avoid breathing vapor. Use with adequate ventilation. Avoid contact with eyes, skin, and clothes. Wash containers, glassware, etc., thoroughly after handling. Keep container tightly closed. E.Z.N.A.® Micro RNA Kits, except the RNA-Solv® Reagent, should be stored at room temperature. RNA-Solv® Reagent should be store at 2-8°C for long term storage. RNA-Solv® Reagent must work in extractor chamber recommended always wear lab coat for avoid spills. Avoid maximum exposition to UV transilluminator, the transilluminator does come with safety lid for viewing the gel. Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 8 MATERIALS Plant material • In vitro cultured plants, fresh and dried leaves. REAGENTS Chemical & reagents Supplier Catalog Storage conditions Chloroform Merck Room temperature Isopropanol (2-propanol) Merck Room temperature Absolute ethanol Merck Room temperature Nuclease free water Refrigerator (+4°C) Glycogen Invitrogen 10814-010 Freezer(-70°C) Agarose Ultrapure Invitrogen 15510-027 Room temperature TAE buffer Room temperature TBE buffer Room temperature 3M Sodium Acetate, pH 4.8-5.2 Refrigerator (+4°C) GelRed ® Biotum. Inc 41003 Room temperature DNA loading buffer SALB 10x Refrigerator (+4°C) E.Z.N.A.® Micro-RNA Kit Omega Bio-Tek R7034-01 Room temperature Gel Extraction Kit (High Pure PCR product Purification kit from ROCHE (or any kit available in the lab.) Roche 11732676001 Room temperature 50 bp DNA ladder Caisson DMR12- 500UL Room temperature Quanti-iT PicoGreen dsRNA assay kit Invitrogen P11496 Refrigerator (+4°C) Enzymes T4 RNA Ligase 1 New England Biolabs - NEB M0204L Freezer(-70°C) T4 RNA Ligase 2, truncated New England Biolabs - NEB M0242L Freezer(-70°C) RNaseOUT (alternative for Africa: include it only in the 1st reaction, then replace it by NFW) Invitrogen 10777-019 Freezer(-70°C) Superscript IIITM Reverse transcriptase or ProtoScript II Reverse Transcriptase (alternative for Africa) Invitrogen New England Biolabs - NEB 18080-044 M0368L Freezer(-70°C) Freezer(-70°C) Phusion High-Fidelity DNA polymerase New England Biolabs - NEB M0530L Freezer(-70°C) dNTP set (100mM) Invitrogen 10297-018 Freezer(-70°C) Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 9 Primers and adapters (Integrated DNA Technologies-IDT): 5' Adapter (RNA oligo, 26 bases, RNase Free HPLC purification): 5'-GUU CAG AGU UCU ACA GUC CGA CGA UC-3' 3' adapter oligo (20 bases, HPLC purification): 5'-/5Phos/CAG ATC GGA AGA GCA CAC GT/3AmMO/-3' RT_primer (20 bases, HPLC purification): 5'-/5AmMC6/ACG TGT GCT CTT CCG ATC TG-3' sRNA PCR 1 (60 bases, standard desalting): 5'AATGATACGGCGACCACCGAGATCTACACGACAGGTTCAGAGTTCTACAGTCCGACGA*T*C-3' PCR2_1 (64 bases, standard desalting)-multiplex: 5'CAAGCAGAAGACGGCATACGAGATATCACGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3' sRNA PCR 1 (60 bases, HPLC purification): 5'AATGATACGGCGACCACCGAGATCTACACGACAGGTTCAGAGTTCTACAGTCCGACGA*T*C-3' PCR2_* (64 bases, HPLC purification)-multiplex: 5'CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3' Barcode sequences Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 10 Supplies Markers for labeling Hand roller Plastic (crystal clear polyethylene) bags Gloves (powder-free) 2 ml microcentrifuge tubes 1.5 ml microcentrifuge tubes 0.5 ml microcentrifuge tubes 1 ml tips 200 µl tips 10 µl tips 0.2 ml PCR tubes & caps (8-strip) Scalpel blades (#11) Racks for Eppendorf tubes Racks for PCR tubes Cryoboxes Micropipettes set (2, 10, 20, 100, 200, 1000 µl) Equipment Analytical balance (accurate milligrams scale) Microcentrifuge (for room temperature and refrigerated 4°C runs) Freezer Agarose gel electrophoresis system Thermocycler (96 well Thermal Cycler) Gel Doc UV transilluminator Qubit® Fluorometer Nanodrop Thermomixer Refrigerator (+4°C) Autoclave Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 11 PROCEDURE This procedure for library preparation of small RNA purified from plant tissue covers different steps from the collection of samples, processing of them to purify the small RNA, preparation of the libraries using barcodes, quantification of libraries, and mixing them in pooled libraries for sending to the sequencing provider. Sample reception Plants are of acceptable quality for RNA extraction if correspond to the following characteristics: • 1 In-vitro plant culture of 5 cm of size which contains more than 10 leaves. • Fresh leaves that have been collected the same day. • Dried leaves with green color (brown color indicates degradation/ oxidation of the sample) Sampling procedure Weighing of the samples • Carefully collect the plantlet using clean forceps and place it in a plastic bag in ice. Note: clean the forceps using 75% alcohol prior to collecting each individual sample. • An analytical balance (with an accurate milligrams scale) is used to weigh the samples on a recipient of aluminum foil. • Weight 100mg of fresh leaves or 20mg from dried leaves (this is the optimal weight of samples). If the 10 leaves from the in vitro plants are not enough, stems and petioles can be used to complete 100 mg. Note: when working with many samples, use 2 or 3 forceps to change them from sample to sample, after cleaning forceps with 75% alcohol. RNA Extraction with E.Z.N.A miRNA kit – Omega Bio-Tek (modified from manufacturers’ protocol) Note: If working with many samples (e.g., 48), do extractions by a set of 18-24 samples. 1. Add 1.0 mL of RNA-Solv® Reagent in the plastic bag containing the fresh sample and grind it with a hand roller. When working with dried leaves, add 80 µl nuclease- free water (NFW) in addition to the 1.0 mL of extraction buffer and let stand it up for 20 to 30 minutes before grinding (this facilitates grinding of sample). 2. Transfer the lysate to a clean 1.5 mL microcentrifuge tube. 3. Let sit at room temperature for 3 minutes. 4. Add 0.2 mL of chloroform per 1 mL of RNA-Solv Reagent. Cap the tubes securely and vortex vigorously for 15 seconds. 5. Let sit on ice for 10 minutes. 6. Centrifuge at 12,000 x g at 4°C for 15 minutes. Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 12 7. Transfer no more than 80% of the upper aqueous phase (~400 μl) to a new 1.5 mL microcentrifuge tube. 8. Add 0.33 volumes (~132 μl) of 100% ethanol. Vortex to mix thoroughly. Note: A precipitate may form after the addition of ethanol Removal of Large RNA (>200 nt) 9. Insert a HiBind RNA Mini Column (orange color) into a 2 mL Collection Tube provided with the kit. 10. Transfer up to 700 μl of the mixture from step 8 to the HiBind RNA Mini Column. 11. Centrifuge at 10,000 x g at room temperature for 1 minute. 12. Transfer the filtrate into a new 2 mL microcentrifuge tube for small RNA isolation. 13. Repeat steps 10-12 until all the remaining sample has been transferred to the column. Note: To isolate large-size total RNA (>200 nt) continue to the “Large RNA from HiBind RNA Mini Column Protocol” in the next Section. For purification of miRNA, continue to Step 14 below. If both miRNA and large RNA (>200 nt) are required, both protocols need to be completed in a single day. Transfer the HiBind RNA Mini Column to a 2 mL collection tube and hold them at 4°C until the miRNA Purification protocol below has been completed. The eluted large RNA fractions are kept for confirmation purposes of viruses detected from the sequence data generated by the small RNA libraries. Purification of Micro RNA 14. Measure the volume of the filtrate collected (~450 μl) at the end of step 13. 15. Add 0.65 volumes (~292.5 μl) of 100% ethanol to the filtrate. Vortex to mix thoroughly. 16. Insert a HiBind Micro RNA Column (white color) into a clean 1.5 mL Collection Tube provided with the kit. 17. Transfer the mixture from step 15 to the HiBind Micro RNA Column. 18. Centrifuge at 10,000 x g for 1 minute. Discard the filtrate and reuse the Collection Tube. 19. Repeat steps 17-18 until the remaining sample has been transferred to the HiBind Micro RNA Column. 20. Add 500 μl RNA Wash Buffer II to the HiBind Micro RNA Column. 1. Note: RNA Wash Buffer II must be diluted with 100% ethanol before use. 21. Centrifuge at 10,000 x g for 1 minute. Discard the liquid and reuse the Collection Tube. 22. Repeat step 20-21 for a second RNA Wash Buffer II wash step. 23. Centrifuge empty Column at maximum speed ( ≥12,000 x g) for 2 minutes to completely dry the HiBind matrix. Note: It is important to dry the HiBind Micro RNA matrix before elution. Residual ethanol may interfere with downstream applications. Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 13 24. Transfer the HiBind Micro RNA Column to a clean 1.5 mL microcentrifuge tube. 25. Add 25 μl Nuclease-free Water (heated to 70˚C before elution. This helps increase RNA yield). Note: Make sure to add water directly onto the HiBind® Micro RNA Column matrix. 26. Let sit at room temperature for 5 minutes. 27. Centrifuge at maximum speed ( ≥12,000 x g) for 1 minute. 28. Repeat the elution step using the eluate from the first elution (this may increase yield while maintaining elution volume). 29. Store eluted small RNA at -70°C. Purification of Large RNA (optional) Note: The Large RNA, immobilized in the HiBind RNA Mini Column (see note between Steps 13 and 14 in previous Section), are purified to be used for PCR confirmation of any virus identified by small RNA sequencing of the sample. 1. Take the HiBind RNA Mini Column inserted in the 2 mL collection tube that was held at 4°C. 2. Add 500 μL RNA Wash Buffer I to the HiBind® RNA Mini Column. 3. Let sit at room temperature for 5 minutes. 4. Centrifuge at 10,000 x g for 1 minute. 5. Discard the filtrate and reuse the Collection Tube. 6. Add 500 μL RNA Wash Buffer II to the HiBind® RNA Mini Column. Note: RNA Wash Buffer II must be diluted with ethanol before use. 7. Centrifuge at 10,000 x g for 1 minute. 8. Discard the filtrate and reuse the Collection Tube. 9. Repeat Steps 6-8 for a second RNA Wash Buffer II wash step. 10. Centrifuge empty Column at maximum speed ( ≥12,000 x g) for 2 minutes to completely dry the HiBind RNA Mini Column. Note: It is important to dry the HiBind RNA Mini Column matrix before elution. Residual ethanol may interfere with downstream applications. 11. Transfer the HiBind RNA Mini Column to a clean 1.5 2 mL microcentrifuge tube. 12. Add 55 μl Nuclease-free Water (heated to 70˚C before elution. This helps increase RNA yield). Note: Make sure to add water directly onto the HiBind® RNA Mini Column matrix. 13. Let sit at room temperature for 5 minutes. 14. Centrifuge at maximum speed ( ≥12,000 x g) for 1 minute. 15. Repeat the elution step using the eluate from the first elution (this may increase yield while maintaining elution volume). 16. Store eluted large RNA at -70°C. Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 14 Small RNA Library preparation 3’ adapter adenylation 1. Dissolve the 3' adapter oligo (5’ phosphorylated and 3’ blocked DNA oligo) in Elution Buffer (10 mM Tris- HCl, pH 8.5) to a final concentration of 100 µM 2. Set up a reaction in 0.2 ml PCR tube containing: Mix by pipetting and incubate overnight at 25°C in a thermal cycler (cover heating set at 50°C) 3. Optional: set up multiple reactions if more adenylated adapters are required 4. Purify the adenylated 3' adapter with Chloroform and Ethanol precipitation 4.1. Bring the sample volume up to 600 µl with nuclease free water (NFW), mix by pipetting. Then, add 300 µl Chloroform. Mix vigorously (20 seconds) 4.2. Centrifuge at maximum speed (14,000 rpm) for 5 min at 4°C 4.3. Take 500 µl of the aqueous phase; add 500 µl isopropanol and 2 µl glycogen (2 µg/µl) 4.4. Incubate at room temperature for 10 min, then, continue incubating at -20°C for 1 hour 4.5. Centrifuge at maximum speed for 30 min at 4°C 4.6. Rinse the pellet (twice) with 75% ethanol (800 µl) 4.7. Centrifuge at maximum speed for 10 min at 4°C 4.8. Remove the supernatant (by pipetting), spin down and carefully remove residual ethanol by pipetting 4.9. Air-dry the pellet (10 min with tube upside down, or 40 min with tube on the side) 4.10. Resuspend the pellet in 30 µl NFW (from a 100 µl Adenylation reaction) 4.11. Determine the concentration in a nanodrop (see nanodrop manual, option ssDNA-33) 4.12. Adjust the adenylated 3' adapter concentration to 10 µM with NFW according to the calculation as shown in the Table and Formula below: http://tools.thermofisher.com/content/sfs/manuals/nd-1000-v3.8-users-manual-8%205x11.pdf Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 15 - Concentration in ng/µl of the adenylated 3’adaper is given by nanodrop set a ssDNA-33. - Concentration in µM of the adenylated 3’adaper is calculated following the formula and considering its MW as 6,451.20 3’ adapter ligation 5. Denature 10 µl (out of 25 µl from step 29 on page 10) of the sRNA sample at 65°C for 45 seconds (in a thermal cycler), immediately chill on ice. 6. In the same way, denature the adenylated 3’ adapter (stock 10 µM, in aliquots of 10 µl) at 65°C for 45 seconds, immediately chill on ice. 7. Set up the ligation reaction as indicated in the Table: Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 16 Mix by pipetting up and down and incubate overnight at 18°C in a thermal cycler (cover heating set at 50°C) Note: ligation reaction must be performed in the absence of ATP to prevent self-ligation of the siRNA that has a 5’ phosphate. 8. Add 0.5 µl reverse transcription primer (20 µM) to the ligation reaction, heat inactivate the reaction at 65°C for 15 min and incubate at 25°C for 10 min, in a thermal cycler 5’ adapter ligation 9. Denature the 5’ adapter (stock 10 µM) at 65°C for 45 seconds (in a thermal cycler), immediately chill on ice 10. Set up the 5' ligation reaction as indicated in the Table below: Mix by pipetting and incubate at 25°C for 4 hours in a thermal cycler (cover heating set at 50°C) Note: the 3’ end of the small RNA has already been ligated to the 3’ adapter that has an amine group at the 3’ end and could no longer take part in the ligation reaction; thus its 5’ end could be ligated to an RNA oligo in the presence of ATP. NOTE: replace RNaseOUT by NFW (an alternative for reducing cost - Africa case) NFW Replace RNaseOUT by NFW (for Africa case) Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 17 Reverse transcription 11. Set up the reverse transcription reaction as indicated in the Table below: 12. Mix by pipetting and incubate the reaction at 50°C for 1 hour, and heat inactivate the reverse transcriptase at 75°C for 15 min; in a thermal cycler PCR test (optional) 13. Set up the PCR reaction as indicated in the Table below: Note: use standard desalted primers sRNA PCR1 and PCR2_1 Run the PCR program in a thermal cycler NFW Replace SuperScript III by ProtoScript II in the Table (including the reaction buffer) Then, incubate the reaction at 42°C for 1 hour, and heat inactive the reverse transcriptase at 65°C for 20 min 5x ProtoScript II Reverse Transcriptase Reaction Buffer ProtoScript II Reverse Transcriptase (200U/µl) Note: replace RNaseOUT and SuperScript III RT by NFW and ProtoScrip II RT, respectively (an alternative for reducing cost - Africa case) Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 18 14. Separate the PCR product on a 2% agarose gel in 1X TAE buffer to confirm the amplification of siRNA libraries (Fig. 2) siRNA library adapter dimer Figure 2. siRNA libraries on a 2% agarose gel in 1X TAE buffer. siRNA libraries (1-8), water controls for 3’ adapter ligation (C), and 50 bp DNA ladder (L). PCR Enrichment Note: each sample which corresponds to one library is labeled with separate barcode sequence (included in the reverse primer PCR2_*) up to 48 different samples that can be pooled together for running in a single lane of an Illumina sequencer. 5 µl 50 bp DNA ladder (Caisson) 7 µl Diluted DNA loading buffer Sample Mix 25 µl PCR product 5 µl DNA loading buffer salB 10x 1 µl GelRed diluted 1/10 Load into the gel: 12 µl 200 100 1 2 3 4 5 6 7 8 C L Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 19 15. Set up the PCR reaction as indicated in the Table below: Note: use HPLC purified primers sRNA PCR 1 and PCR2_* Run the PCR program in a thermal cycler 16. Separate the PCR products on a 2% agarose gel in 1X TBE buffer (0.5X TBE also works well) Note 1: PCR enrichment products need to be processed (or cleaned) as soon as the PCR cycling finishes; otherwise, the nucleic acids may be affected. • 1.8 μl GelRed Sample Mix • 30 µl PCR enrichment product • 3 µl DNA loading buffer salB 10x • 1.5 µl GelRed diluted 1/10 • 5 µl 50 bp DNA ladder (Caisson) • 15 µl Diluted DNA loading buffer Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 20 Note 2: The exposure of nucleic acids to UV light should be done rapidly because long exposures cause significant damage (degradation) to the sample. Note 3: Excise the band (as small as possible) corresponding to the siRNA library (Fig. 3) into a 2 ml microcentrifuge tube and proceed with the Gel Extraction Kit, according to manufacturer’s instructions. sRNA library (~150 bp) adapter dimer adapter dimer Figure 3. siRNA libraries on a 2% agarose gel in 1X TBE buffer. siRNA libraries (1-8), water control for 3’ adapter ligation (C), and 50 bp DNA ladder (L). Purification of siRNA library with High Pure PCR Product Purification Kit – Roche (modified from manufacturers’ protocol) Note: Alternatively, use any kit for purifying PCR product from agarose gel that is available in the laboratory. 1. Place a clean wrap over the transilluminator box, before placing the gel over it (this is to avoid contamination) 2. Cut desired DNA band from gel using a blade (#11) Note: Minimize gel volume by visualizing DNA and cutting the smallest possible gel slice on a UV transilluminator box 3. Weigh the gel slice on an analytical balance (accurate milligrams scale). After some experience, the average weight can be used and not every sample needs to be weighed. Note: When working with many samples, try to cut agarose gel slides with a weight of ~150 mg. In this way, 450 µl of binding buffer is added to each of them. 4. Add 450 µl de binding buffer for every 150 mg de agarose gel slice to the microcentrifuge tube 5. Dissolve agarose gel slice to release the DNA: • Vortex the microcentrifuge tubes for 15 - 30 s to resuspend the gel slice in the binding buffer. 1 2 3 4 5 6 7 8 C L 200 bp 100 bp 200 bp 100 bp Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 21 • Incubate the suspension for 10 minutes at 56˚C in a thermomixer machine at 500 rpm speed • Vortex the tube briefly every 2-3 min during incubation. 6. After the agarose gel slice is completely dissolve: • Add 200 µl isopropanol for every 150 mg agarose gel slice to the tube. • Vortex thoroughly. 7. Insert one High Pure Filter Tube into one Collection Tube. • Pipette the entire contents of the microcentrifuge tube into the upper reservoir of the Filter Tube. Note: Do not exceed 700 µl total volume. If mixture is > 700 µl, repeat the process with the remain volume using the same Filter Tubes 8. Centrifuge 1 min at 10000 rpm. 9. Discard the flowthrough solution. • Reconnect Filter Tube with the same Collection Tube. 10. Add 600 µl Wash Buffer to the upper reservoir. • Centrifuge 1 min at 10000 rpm. 11. Discard the flowthrough solution. • Recombine Filter Tube with the same Collection Tube. • Add 200 µl Wash Buffer. • Centrifuge 1 min at 10000 rpm. Note: This second 200 µl wash step ensures optimal purity and complete removal of Wash Buffer from the glass fibers. 12. Centrifuge empty Column at 10000 rpm for 1 minutes to completely dry the glass fiber 13. Discard the flowthrough solution and Collection Tube. • Recombine Filter Tube with a clean 1.5 ml microcentrifuge tube. 14. Add 30 µl Elution Buffer to the upper reservoir of the Filter Tube. • Wait 5 min for the Elution Buffer to wet the filter. • Centrifuge 1 min at 10000 rpm. 15. Repeat elution with the same elute by recovering the elute (Library) with a pipette and pass it a second time in the same Filter Tube. • Centrifuge 1 min at 10000 rpm. 16. The microcentrifuge tube now contains the purified DNA (Library). • Store the eluted DNA at +4°C or -20°C Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 22 Library Quantification For Calibration Curve and reading, follow the procedure indicated in the User Guide (QubitTM 4 Fluorometer), Quick Reference Guide (QubitTM 4 Fluorometer). Ensure that all reagents are at room temperature before beginning. Store the DNA standard at 4˚C. Figure 4 below shows graphically the procedure to follow for quantifying libraries Figure 4. Quantification of libraries: it is shown how to prepare working solutions, mixing them before quantifying dsDNA (Libraries) concentrations using Qubit 2.0 Fluorometer. Reagent Preparation 1X TE: • The Quant-iT PicoGreen dsDNA Assay Kit contains 20X TE Buffer which is diluted to 1X by adding the 19 volumes of nuclease-free water. PicoGreen Working solution 1X: The PicoGreen reagent Quant-iT fluorophore is provided at a 200X concentration. Dilute • the PicoGreen reagent 1:200 (v/v) with 1X TE buffer (1 volume of PicoGreen reagent and 199 volumes of 1X TE buffer). • Prepare fresh PicoGreen working solution each time when required for samples and standard (positive and negative controls) Prepare Samples and standards (controls) mix for their quantification: • Use 0.5 ml clear, thin-walled PCR tubes to correctly quantify the amount of dsDNA. • Mix 98 µl of 1X TE, 2 µl of sample dsDNA and 100 µl PicoGreen Working solution 1X in the 0.5 mL PCR tube, in that order respectively. Note: prepare volumes of reagents according to the number of libraries to be quantified (Fig. 5). https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0017209_Qubit_4_Fluorometer_UG.pdf https://assets.thermofisher.com/TFS-Assets/BID/manuals/MAN0017210_Qubit_4_Assays_QR.pdf Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 23 • Vortex all tubes for 2-3 seconds. • Incubate the tubes for 2 minutes at room temperature • Insert the tubes in the Qubit 2.0 Fluorometer and take readings (QF values). • Calculate Libraries concentration (ng/µl) according to the formula below: Qubit Readings Date Conc. determined with a Qubit 2.0 fluorometer Library mix: SET 1 QF value Sample Conc. Sample ID Conc. Units Conc. Units ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl ng/ml 0 ng/µl Ctrl (10 ng/μl) ng/ml 0 ng/µl Working sol. <0.50 ng/ml Sample Volume (µL) 2 Dilution Factor 200 X = sample volume (µl) added to the assay tube 𝑺𝒂𝒎𝒑𝒍𝒆 𝑪𝒐𝒏𝒄. = QF value * ( 𝟐𝟎𝟎 ) * ng/µl 𝟏 𝑿 𝟏,𝟎𝟎𝟎 Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 24 Figure 5. Preparation of volumes of reagents and solutions enough for quantifying 19 samples using Qubit 2.0 Fluorometer. Multiplex Library Mixing 1. Order and record the libraries in the format sheet, according to their labeling with the barcodes 2. Mix equal amount (12 ng) of each Library and concentrate volume in a speed vac 3. Dispense at least 10 µl pooled libraries with a final concentration no less than 2 ng/µl for each lane of Illumina sequencing (it is referable 5.76 ng/ µl). 4. Store pooled Libraries at least -20˚C until sending to the sequencing provider Calculating dsDNA Library Concentration (converting ng/µl to nM) Note: For sequencing service, Genesupport (former FASTERIS) requires purified ready-to-run library at following concentration: 10nM, minimal volume of 10 µL For accurate quantification, a dsDNA-specific fluorescent dye method is used to typically measure dsDNA concentration in ng/µl. To convert from ng/µl to nM follow the formula: 𝐶𝑜𝑛𝑐𝑒𝑛𝑡𝑟𝑎𝑡𝑖𝑜𝑛 𝑖𝑛 𝑛𝑀 = (concentration in ng/µl) (660 g/mol)(average library size in bp) x 106 Considering a library concentration of 5.75 ng/µl and the average library size of 147.5 bp (Fig. 6), then its concentration is 59.07 nM. Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 25 Figure 6. DNA library product. Its size is between 146-149 nts (average 147.5 nts), after ligating adapters to their 3’- and 5’-end of the small RNA (siRNA, of 21-24 nts), followed by reverse transcription and PCR reaction with primers that annealing with the ligated adapters to the siRNA. INTERNAL QUALITY CONTROL Control sample High throughput sequencing is extremely sensitive and prone to cross sample contamination within a same lane of sequencing that can lead to false positives in virus detection. To provide a control for the level of cross sample contamination with a lane of sequencing as well as an independent control of the quality of the whole process of virus identification, a control sample is added as one of all the libraries mixed to be run in a lane of Illumina sequencing (usually 48). This sample should contain a known virus which is distinct from any virus known to infect the samples that are being tested, so it can easily be distinguished, and should ideally produce a large amount of virus derived siRNA. After the process, the virus should be easily identified from that sample and thus serves as a control for the overall process. At the same time contamination from the control sample can easily be identified in the test samples providing an estimated level of cross sample contamination expected in the run. This estimated contamination level can be used to calculate a threshold for considering samples positive. The procedure for doing this is described in SOP about Data Management and Bioinformatic Procedure. NNNNNN Sequencing primerAdapter for clustering Adapter for clusteringsiRNA: 21-24nt barcode: 6 nt Adaptor 18nt 45-48nts PCR1_1: 5’‐AATGATACGGCGACCACCGAGATCTACACGACAGGTTCAGAGTTCTACAGTCCGACGAT*C‐3’ PCR2_1: 3’‐A*GATCGGAAGAGCACACGT CTGAACTCCAGTCAC‐NNNNNN‐ATCTCGTATGCCGTCTTCTGCTTG 5’ Adapter (RNA oligo) small RNA 5’‐GUUCAGAGUUCUACAGUCCGACGAUC Adenylated 3’ Adapter (DNA oligo) /5Phos/CAGATCGGAAGAGCACACGT/3AmMO/ sRNA PCR 1: 5’‐AATGATACGGCGACCACCGAGATCTACACGACAGGTTCAGAGTTCTACAGTCCGACGA*T*C‐3’ Product Length: 146‐149 RT primer: 3’‐GTCTAGCCTTCTCGTGTGCA/5AmMC6/ Length: 20 Length: 21‐24 Length 64 Length: 60 Length: 26 Length: 20 Length: 60 Oligos for small RNA library preparation Adapted from Chen et al. Plant Methods 2012, 8:41 ???????????????????????? Small RNA Sequencing and Assembly (sRSA): RNA extraction and small RNA library preparation for Illumina sequencing 26 REFERENCES Chen, Yun-Ru., Zheng,Y., Liu,B.,Zhong,S., Giovannoni,J., Fei, Z. 2012. A cost-effective method for illumina small RNA-seq library preparation using T4 ligase 1 adenylated adapters. Plant Methods,8:41. Gutierrez, D. L., Fuentes, S., and Kreuze, J.F. 2018. Protocols for siRNA Sequencing v2.0. International Potato Center (CIP), Lima Peru INTRODUCTION SCOPE SAFETY MATERIALS PROCEDURE Sample reception Sampling procedure Weighing of the samples RNA Extraction with E.Z.N.A miRNA kit – Omega Bio-Tek (modified from manufacturers’ protocol) Removal of Large RNA (>200 nt) Purification of Micro RNA Purification of Large RNA (optional) Small RNA Library preparation 3’ adapter adenylation 3’ adapter ligation 5’ adapter ligation Reverse transcription PCR test (optional) PCR Enrichment Purification of siRNA library with High Pure PCR Product Purification Kit – Roche (modified from manufacturers’ protocol) Library Quantification Reagent Preparation PicoGreen Working solution 1X: Prepare Samples and standards (controls) mix for their quantification: Multiplex Library Mixing Calculating dsDNA Library Concentration (converting ng/µl to nM) INTERNAL QUALITY CONTROL Control sample REFERENCES