31.1/2006 June 2006 International Rice Research Institute IRRI home page: http://www.irri.org Riceweb: http://www.riceweb.org Riceworld: http://www.riceworld.org IRRI Library: http://ricelib.irri.cgiar.org IRRN: http://www.irri.org/irrn.htm International Rice Research Notes Copyright International Rice Research Institute 2005 NOTICE: This journal is copyrighted in the name of the International Rice Research Institute (IRRI). IRRI has the exclusive right to reproduce or au- thorize reproduction of the copyrighted work, to prepare derivative works based upon the copyrighted work, and to distribute copies of the copyrighted work to the public for sale or other transfer of ownership. You may copy, duplicate, or otherwise reproduce any of the articles or portions of the articles in the copyrighted work; but you must acknowledge the journal and its copyright owner as the source of the copyrighted work. You may not modify, translate, or use the data herein contained to prepare a derivative work without the prior written consent of the copyright owner. Contents About the cover: Researchers gather raw data from the fi eld that would later be used, using MINI REVIEW bioinformatics tools, to develop information systems that would help solve current problems in 5 Bioinformatics and crop information rice research. systems in rice research Richard Bruskiewich, Thomas Metz, and Graham McLaren Cover photo: Bogsi Panaligan Genetic resources 13 Dhanrasi, a new lowland rice variety with Oryza 18 Rajendra Sweta, a new high-yielding quality rice rufi pogon genes for improving yield potential and variety for Bihar’s irrigated ecosystem resistance to biotic stresses V.N. Sahai and R.C. Chaudhary T. Ram, N.D. Majumder, and B. Mishra 15 NDR2026: a new rice variety released for mid- 19 Karjat 6, a new, superfi ne medium-duration rice early irrigated areas of Uttar Pradesh, India variety in Maharashtra, India J.L. Dwivedi, R.S. Verma, S.P. Giri, A.K. Tripathi, B.V. Ingale, B.D. Waghmode, V.V. Dalvi, and and R.N. Vishwakarma A.P. Rewale 16 CSR23: a new salt-tolerant rice variety for India 20 Sahyadri 2, an early rice hybrid for Maharashtra R.K. Singh, G.B. Gregorio, and B. Mishra State in India B.V. Ingale, N.D. Jambhale, B.D. Waghmode, and V.V. Dalvi Pest science & management 22 Analysis of Pyricularia grisea populations from 24 Record of a hyperparasitoid on Pseudogonatopus three different blast epidemics nudus Perkins (Dryinidae: Chrysidoidea) parasit- D. Mishra, U.D. Singh, A.B. Dash, J.N. Reddy, izing Nilaparvata lugens (Stål) from Asia R. Sridhar, M.L.C. George, C.M. Vera Cruz, M.A. S. Manickavasagam, A. Prabhu, and Bernardo, H. Leung, and R. Sridhar R. Kanagarajan 2 June 2006 26 Endo- and ectoparasites of the Philippine rice fi eld rat, Rattus tanezumi Temminck, on PhilRice farms M.M. Antolin, R.C. Joshi, L.S. Sebastian, L.V. M arquez, U.G. Duque, and C.J. Domingo Soil, nutrient, & water management 28 Effects of cultivating a rice crop under aerobic 29 The nature of humic substances under long-term conditions with fi lm mulching on soil microbial manuring and fertilization in a rice-wheat system activity D.K. Das and Nand Ram Cai Kunzheng, Luo Shiming, and Fang Xiang Socioeconomics 32 Impact analysis of Technology Assessment 35 Farmer participatory learning on integrated crop and Refi nement through Institution-Village management of lowland rice in Mali Linkage Program F.E. Nwilene, M.A. Togola, O. Youm, and K.D. Kokate and L.G. Pawar A. Hamadoun 32 A preliminary forecast of the intensifi cation of 37 TAR- IVLP: an effective institutional mechanism global and regional rice production for assessing the appropriateness of rice varieties Wenjun Zhang and Yanhong Qi P. George Joseph, K.P. Santhosh Kumar, M. Anantharaman, and S. Ramanathan 39 NOTES FORM THE FIELD 40 DESIGNATION OF IRRI BREEDING LINES 44 INSTRUCTIONS TO CONTRIBUTORS Editorial Board Production Team Jagdish K. Ladha, editor-in-chief Tess Rola, managing editor Yolanda Chen (pest science and management) Editorial Zhikang Li (plant breeding; molecular and cell biology, China) Bill Hardy John Bennett (plant breeding; molecular and cell biology, Los Baños) Cover and graphic design Sushil Pandey (socioeconomics; agricultural engineering) Grant Leceta Abdelbagi Ismail (crop management and physiology) Editorial assistance Stephan Haefele (soil, nutrient, and water management; environment) Diane Martinez Edwin Javier (genetic resources) IRRN 31.1 3 MINI REVIEW Bioinformatics and crop information systems in rice research Richard Bruskiewich, Thomas Metz, and Graham McLaren The triple revolution in biotechnology, computing science, and communication technology has stimulated informatics applications in rice research. This review specifi cally covers the impact of biology-focused informatics (“bioinformatics”) in rice research on the discovery of genotype-phenotype relationships for priority traits, using diverse data sources. Bioinformatics is a scientifi c discipline lying at the intersection of biology, mathematics, computing science, and information technology. Bioinformatics can be discussed within the following frameworks: • Applications: What kind of research questions can be answered using b ioinformatics? • Databases: What data sources and applicable semantic standards (ontology1) are pertinent to answering these research questions? • Protocols, algorithms, and tools: What analysis protocols, computing algorithms, and software tools can be applied to answer these research questions? 1 Ontology refers to the formal defi nition of a dictionary of concepts and their interrelationships. There are many international bioinformatics efforts in this area, such as Gene Ontology (www.geneontology.org) and Plant Ontology (www.plantontology.org), pertinent to crop research. IRRN 31.1 5 • Infrastructure: What hardware, software, and sociated with this tapestry of germplasm function networking systems are required to support the are summarized in Figure 1. above? This review will focus primarily on germplasm- Germplasm based crop research, although many of the same Proper management of germplasm information is tools can be applied to current problems in soil essential for the elucidation of genotype-expression- microbiology, entomology, and other areas of crop phenotype associations. Management goals include research. Also, some of the design principles of systematic tracking of germplasm origin (passport bioinformatics information systems will be useful and genealogy information), recording of alternate for other research fi elds, such as geographic and germplasm names, accurate linkage of experimental agronomic information systems. results to applicable genotypes, and proper material management of germplasm inventories. Bioinformatics applications in crop research An important aspect of any good germplasm The fundamental scientifi c question underlying information system is the separation of the manage- germplasm research is, What is the causal relation- ment of nomenclature from identifi cation. Users ship between genotype and phenotype? DNA is must be free to name germplasm as they like, and transcribed into RNA, which is either bioactive the system must make sure the names are bonded itself (as noncoding RNA gene products) or is to the right germplasm. A key to effective manage- translated into peptides that form part of protein ment of such variable germplasm information is gene products. Ultimately, these products act as the assignment of a unique germplasm identifi er structural elements, genetic regulatory control fac- (GID) to each distinct germplasm sample—seed tors, or modulators of the biochemical fl uxes within package or clone—that needs to be tracked (“bar metabolic and physiological pathways, at the sub- coded”). The acid test is to ask whether or not mix- cellular, tissue, organ, and whole organism level. ing two germplasm samples together will result in This sum total of molecular expression integrates to an unacceptable loss of biological or management give the overall structural and behavioral features information. If the answer to this question is “yes,” of the plant—its “phenotype.” The unfolding of this then each sample should be assigned a distinct story also has an essential environmental context, in- GID. The GID is the essential reference point for cluding biotic (ecosystem) and abiotic (geophysical) managing all meta-data about the germplasm, for factors modulating expression in a variety of ways accurately attributing all experimental observa- via diverse sensory and regulatory mechanisms in tions made about that sample, and for cross-linking the plant. Various classes of experimental data as- related germplasm samples with one another, for          '      #                                         '          !               %           &    #    !  "    #  $    #   !   Fig. 1. Biological and information relationships in germplasm research. 6 June 2006 example, the parents (sources) and progeny of the Answering such questions will often lead to given sample, including membership of the sample deeper exploration of germplasm, such as evo- in global “management neighborhoods.2” lutionary studies, practical management of plant Once assigned, a GID is never destroyed, but crosses, and genetic resource management. rather persists in the crop database long after the as- Molecular variation that is biologically signifi - sociated sample has become unavailable (after being cant is that postulated to be causally correlated with fully consumed, nonviable, or otherwise lost). In this differences in structure (i.e., genome content or ar- manner, historical information about germplasm rangement), biochemical function (resulting from may be effi ciently integrated with information about critical functional changes in RNA bases or amino extant descendants of that germplasm. Although acid residues), or regulation of gene products (by a given GID is generally a database primary key affecting promoter or enhancer sequences). defi ned locally to a given database, it should be Whatever the nature of genotype measure- convertible into a globally unique identifi er within ments, the primary task of bioinformatics is to a community of germplasm databases. There are completely capture and accurately codify the raw various protocols for achieving this, for example, and derived genotype data. Bioinformatics also the life science identifi er (LSID) protocol.3 This applies statistical algorithms to raw genotype mea- requirement is not unique to GID usage. In fact, surements to make useful inferences such as locus most biological data to be shared by a distributed assignments on genetic and physical maps, assess- community should be assigned global identifi cation ments of germplasm relatedness and biodiversity, in this manner. or assays of the impact of molecular variation on the biological system. Bioinformatics methodol- Genotypes ogy assists in all stages of genotyping experiments Genotypes can be characterized at various levels of and in the interpretation of results: from raw data abstraction and resolution. In all instances, what is capture (e.g., gel image processing), documentation, being measured and tracked across meiotic events, and storage to semiautomated analysis of raw data either directly or indirectly, is sequence variation into inferences (i.e., germplasm fi ngerprinting and (“alleles”) in the DNA of organisms. Experimental mapping, alignments of DNA variation to RNA and systems conceived to make those measurements are protein structures to elucidate functional variance, designated “markers.” Markers can be any scientifi c etc.) through visualization and publication of the protocol used to observe a biological process caus- information. ally coupled to the molecular variation of interest. A growing foundation for modern genotyping This broad defi nition includes laboratory measure- is, of course, the sequence-level structural charac- ments of DNA (e.g., polymerase chain reactions or terization of plant genomic DNA, an activity within DNA-DNA hybridization events) and simple obser- which bioinformatics has played an enormous tech- vations of visible phenotypes (e.g., classical visible nical role. The publication of the Arabidopsis thaliana genetic markers such as morphological variants). genome in 2000 (AGI 2000) gave plant biologists a The molecular variation measured by genotyping major information resource for indexing current can be neutral or biologically signifi cant. and future understanding of plant genotypes. Since Neutral molecular variation generally involves that time, a complete survey of the rice genome markers that simply exhibit DNA structural poly- sequence has also become available (IRGSP 2005). morphism that is usefully applied to answer the Several other crop genome-sequencing projects are following basic questions: rapidly constructing a rich and diverse repository • To what extent are germplasm samples similar of public information about plant DNA sequence to or different from one another (i.e., “fi nger- structure across many species, which will enable printing” experiments)? signifi cant and fruitful future studies in compara- • What is the chromosome location of a marker tive genomics. (i.e., “mapping” experiments)? 2 A “management neighborhood” of germplasm is defi ned as the entire population of germplasm that essentially shares and is intended to conserve the distinct genetic composi- tion of a specifi ed founding germplasm sample. This concept fi nds utility in institutional decisions to conserve, describe, and globally share specifi ed germplasm sets like mapping populations (e.g., Azucena/IR64), genomics stocks (e.g., mutants), parental breeding releases (e.g., cultivar releases like IR64), and accessions held in genetic resource collections. 3 See http://lsid.sourceforge.net/. IRRN 31.1 7 Phenotypes processes, for example, as contributors to specifi ed Bioinformatics management of phenotype data agronomic traits of interest. The overall strategy is primarily focuses on cataloging simple phenotypes. that of intersecting evidence from positional, func- Bioinformatics researchers, such as in the Open Bio- tional, expression, selection, and crop modeling medical Ontologies initiative (http://obo.source- information sources (Fig. 2). forge.net), are cataloging controlled vocabulary and ontology to formalize phenotype descriptions by Databases cross-linking concepts of “observable,” “attribute,” Computerized databases are a relatively recent and “value.” A simple application of this paradigm innovation in biology, expanding dramatically in is the following phenotype specifi cation: leaf (ob- scope, usage, and online accessibility during the servable) color (attribute) is red (value). Observables 1990s. At the cornerstone of modern biological for plants can be codifi ed using plant anatomy and research are the international public sequence data- developmental process terms being defi ned by the bases, of which there are three major ones: Genbank Plant Ontology Consortium (POC) (www.planton- at the National Center for Biotechnology Informa- tology.org; POC 2002). IRRI scientists are collabo- tion (NCBI; www.ncbi.nlm.nih.gov), the European rating with POC and others to systematically index Molecular Biology Laboratory (EMBL) sequence descriptions for phenotypes of interest relating to database hosted at the European Bioinformatics agronomic traits such as yield, biotic and abiotic Institute (EBI; www.ebi.ac.uk), and the DNA Data stress tolerance, and improved grain quality. Bank of Japan (DDBJ; www.ddbj.nig.ac.jp). In fact, basic sequence data submitted to any of these three Molecular expression databases are automatically mirrored to the other Moving beyond the map characterization of ge- two databases on a routine basis, so visiting any one nomic DNA highlighted above, the task of func- of the databases usually suffi ces for basic data. Each tional genomics (and other “-omics” fi elds such as site, however, has specialized information resources proteomics and metabolomics) is to characterize the worth exploring independently. dynamic picture of molecular expression within the Although Web user interfaces for these sequence living organism at the level of RNA, protein, and databases are well developed, deployment of local metabolites. The rice genome contains thousands of copies of major public and semipublic databases predicted genes. The primary motivation of func- pertinent to crop research permits higher effi ciency tional genomics research is to narrow down the list for repetitive high-throughput searches that result of candidate genes implicated in specifi ed biological from the processing of large experimental data sets. Fig. 2. Intersecting evidence for candidate genes. 8 June 2006 The “BioMirror” project (www.bio-mirror.net/) The International Crop (Rice) Information System provides valuable database mirroring facilities in The International Crop Information System (ICIS; this regard. www.icis.cgiar.org) is an “open-source” and Beyond sequence data, the range of pertinent “open-licensed” generic crop information system5 functional genomics experiments and associated under development since the early 1990s by the data is too extensive to fully enumerate here, but CGIAR, national agricultural research and ex- several public sources of such crop-related bioinfor- tension systems, agricultural research institutes, matics data are listed in the table. The reader is also and private-sector partners (McLaren et al 2005, encouraged to consult various books and journal Bruskiewich et al 2003, Fox and Skovmand 1996). reviews providing surveys of available resources.4 Using the GID protocol previously discussed, ICIS Some excellent online indices of data sources (and is designed to fully document germplasm genealo- related software tools) exist, for example, the Expasy gies6 with associated meta-data such as passport Life Sciences Directory (www.expasy.org/links. data and to a ccurately cross-link germplasm entries html). with associated experimental observations7 from Table 1. Partial inventory of online public rice/crop/plant bioinformatics databases. Database Description/organism URL Rice Genome Project/IRGSP International Rice Genome Sequencing Project http://rgp.dna/affrc.go.jp/IRGSP RAP DB “Rice Annotation Project” database http://rapdb.lab.nig.ac.jp TIGR Rice TIGR rice genome database www.tigr.org/tdb/e2k1/osa1/ BGI Rice Information System (BGI) Indica (93-11) rice genome data http://rise.gneomics.org/cn/rice/index2.jsp Oryzabase NIG Oryza genetics database www.shigen.nig.ac.jp/rice/oryzabase Gramene Comparative grasses, anchored on rice www.gramene.org MOsDB MIPS Oryza sativa database http://mips.gsf.de/proj/plant/jsf/rice/index.jsp IRIS International Rice Information System www.iris.irri.org IRFGC International Rice Functional Genomics Consortium www.iris.irri.org/IRFGC Web site OryzaSNP IRFGC hosted rice single nucleotide polymorphism www.oryzasnp.org (SNP) survey OMAP Comparative genome physical maps of Oryza wild www.omap.org relatives MPSS Massive parallel signature sequencing gene expression http://mpss.udel.edu data RED (NIAS) rice expression database http://cdna02.dna.affrc.go.jp/RED Rice Array Db NSF-funded oligo rice gene expression array www.ricearray.org Yale Plant Genomics Gene expression from tiling path arrays and rice tissues http://plantgenomics.biology.yale.edu/ Rice Proteome Database NIAS rice proteome database http://gene64.dna.affrc.go.jp/RPD/main_en.html Tos17 rice mutants NIAS rice TOS 17 insertion mutants http://tos.nias.affrc.go.jp T-DNA Rice Insertion lines (Gyn An) Korean T-DNA rice insertion mutants www.postech.ac.kr/life/pfg OryGenesDb (CIRAD) Reverse genetics for rice http://orygenesdb.cirad.fr/ KOME database Knowledge-Based Oryza Molecular Biological Encyclo- http://cdna01.dna.affrc.go.jp/cDNA pedia RIKEN Arabidopsis and rice functional genomics data www.gsc.riken.go.jp/eng/output/topics/plant.html Rice Blast Magnaporthe grisea genomics www.riceblast.org Genevestigator (Gruissem) Gene networks in Arabidopsis and rice http://genevestigator.ethz.ch MaizeGDB Maize www.maizegdb.org PlexDB Plant expression data www.plexdb.org/ GRIN Plant genetic resources www.ars-grin.gov/ TAIR The Arabidopsis Information Resource www.arabidopsis.org NASC Arabidopsis thaliana http://arabidopsis.info/ MATDB Arabidopsis thaliana http://mips.gsf.de/proj/thal/db/ PLACE db Plant cis-acting regulatory DNA elements database www.dna.affrc.go.jp/PLACE PlantCare Plant cis-acting regulatory DNA elements database http://intra.psb.ugent.be:8080/PlantCARE/ NCBI Plant Plant genomes central at NCBI www.ncbi.nlm.nih.gov/genomes/PLANTS/PlantList.html EXPASY Index to other plant-specifi c databases www.expasy.org/links.html 4 Nucleic Acids Research has a “database edition” at the start of each calendar year with an online index (www3.oup.co.uk/nar/database/). See also Plant Physiology, May 2005, Vol. 138, wh ich recently published an extensive set of review papers on available plant databases. 5 “Open source” refers to the accessibility of the computer source code of the system. “Open license” essentially means that anyone can freely use and modify the code for their use. “Generic” means that it is adaptable to any other crop (not just rice). 6 The ICIS Genealogy Management System (GMS) effi ciently tracks the extended network of GID relationships and the meta-data associated with each GID. 7 The ICIS Data Management System (DMS) documents studies of germplasm using a biometric “study” model mildly reminiscent of a computer spreadsheet. In fact, some DMS input and display tools are based on Excel. IRRN 31.1 9 evaluations undertaken in the fi eld, greenhouse, tools can be used to apply such protocols and algo- or laboratory. rithms to crop research problems. A few representa- ICIS meets the need for global identifi cation of tive tools will be mentioned here. GID and other data objects (e.g., fi eld studies) by The European Molecular Biology Open Soft- maintaining globally unique information about the ware Suite (EMBOSS; www.emboss.org) is an open- local database installation and user who created the source sequence-analysis package that provides entry, as the authority for the information assigned more than 200 sequence analysis utilities, including to a given ICIS object identifi er. This entry may wrappers for most publicly available algorithms eventually be published in a central ICIS repository such as pairwise and multiple sequence alignments, and receive a second new “public” identifi er cross- primer design, and sequence feature recognition linked to the original identifi er. Such ICIS object algorithms. EMBOSS also reads and writes a wide identifi ers (e.g., GIDs) like LSIDs are not names, variety of sequence and annotation formats. The and, although they do contain some information Open-Bio community (www.open-bio.org) is host on domain and authority, no one will generally use to a series of computer language-specifi c bioinfor- them as names for germplasm. matics tool kits useful for bioinformatics data trans- In addition to specifying a common database formation scripts and Web site development. The schema, the ICIS community has collaboratively Generic Model Organism Database project (GMOD; developed many freely available8 specialized soft- www.gmod.org) is a clearinghouse of many freely ware analysis tools and interfaces for the system for available, open-source software tools for manag- effi ciently documenting, analyzing, and retrieving ing and manipulating biological information in information about germplasm samples and studies. databases. Another good source of freely available, These include practical tools (Fig. 3) to manage lists open-source tools is the TIGR software site (www. of germplasm for plant crosses, evaluative nurseries, tigr.org/software), which has various software and collections.9 systems useful in particular experimental contexts. The public rice implementation of ICIS is IRRI’s For proteomics tools, the Expasy Web site at the fl agship germplasm database, the International Rice Swiss Institute of Bioinformatics (www.expasy.ch) Information System (IRIS; www.iris.irri.org). IRIS is a valuable resource. For metabolomics tools, the currently contains about two million germplasm Systems Biology Markup Language site (SBML; (GID) entries with millions of associated data points www.sbml.org) is a good starting point. in hundreds of experimental studies, including A principal limitation of many online databases many phenotypic observations and a growing is their dependence on regular Web server interfaces number of genotypic measurements. IRIS also pub- for data publication, interfaces solely searchable lishes phenotype information for the Institute’s IR64 using standard Web browsers. Technologies such rice mutant collection (Wu et al 2005). This latter as semantic Web languages and Web services pro- information is searchable using a query interface tocols are being explored as a means of creating permitting the specifi cation of mutant phenotypes frameworks for “computer program-friendly Web using the “observable,” “attribute,” and “value” surfi ng,” such that more powerful client software model previously discussed. IRRI scientists have than Web browsers can be designed, implemented, generated a number of high-throughput data sets, and deployed on the biologist’s desktop. One such including genetic maps; transcript, protein, and me- protocol is BioCASE (www.biocase.org). Another tabolomic expression experiments; and genotypic notable protocol is the BioMOBY project (www. measurements on a growing set of germplasm. biomoby.org; Wilkinson et al 2005) that is striving Many of these data sets are now published in IRIS to apply biological semantics in a formal manner to or in collaborating databases such as Gramene. integrate bioinformatics data sources and computa- tional services into complex workfl ows that can be Protocols and tools managed and visualized by sophisticated clients, Bioinformatics analysis requires a very broad range such as the Taverna workfl ow tool (http://taverna. of protocols and algorithms. Many freely available sourceforge.net/). 8 Information and links to ICIS tools are available off the ICIS Web site at www.icis.cgiar.org. 9 Including specialized tools for genetic resource collection management. 10 June 2006 Fig. 3. Sample screen images of some ICIS software tools. IRRN 31.1 11 Future challenges Society for Computational Biology (www.iscb. IRRI fi nds itself involved in various international org) serves as a global community of practice in research consortia and alliances, in particular, the the fi eld; the Asia Pacifi c Bioinformatics Network International Rice Functional Genomics Consortium (www.apbionet.org) is a good regional source of (IRFGC; www.iris.irri.org/IRFGC), the Generation bioinformatics information in Asia. Challenge Programme (GCP; www.generationcp. org) (Fig. 4), and a formal alliance with CIMMYT.10 References Such partnerships require much greater integra- AGI (The Arabidopsis Genome Initiative). 2000. Analysis of tion across data resources and research outputs, the genome sequence of the fl owering plant Arabidopsis thaliana. Nature 408:796-815. integration that will require the application of Baxevanis AD, Ouellette BFF, editors. 2005. Bioinformatics: novel state-of-the-art bioinformatics methodology a practical guide to the analysis of genes and proteins. and technologies, developed as a team effort across New York: John Wiley & Sons, Inc. many institutes. The GCP in particular has a formal Bruskiewich R, Cosico A, Eusebio W, Portugal A, Ramos subprogram for crop information platform and net- LR, Reyes T, Sallan MAB, Ulat VJM, Wang X, McNally work development that is accelerating the pace of KL, Sackville Hamilton R, McLaren CR. 2003. Linking genotype to phenotype: the International Rice development of bioinformatics standards and tools Information System (IRIS). Bioinformatics 19 (Suppl.1): for crop research. These tools will soon be freely i63-i65. downloadable from a Web site called “CropForge” Claverie JM, Notredame C. 2003. Bioinformatics for (www.cropforge.org), which also now hosts the dummies. New York: Wiley Publishing, Inc. latest releases of ICIS software. Fox PN, Skovmand B. 1996. The International Crop Information System (ICIS)—connects genebank to breeder to farmer’s fi eld. In: Cooper M, Hammer GL, Summary editors. Plant adaptation and crop improvement. Bioinformatics is a rapidly expanding and evolv- Wallingford (UK): CAB International. p 317-326. ing fi eld. Like any such fi eld, keeping up with new Gibas C, Jambeck P. 2001. Developing bioinformatics resources and methodology is a taxing quest. Many computer skills. Cambridge, Mass. (USA): O’Reilly and good introductory books are now available to help Associates. IRGSP (International Rice Genome Sequencing Project). 2005. crop researchers apply bioinformatics to their own The map-based sequence of the rice genome. Nature research problems (see Mount 2001, Gibas and 436:793-800. Jambeck 2001, Lacroix and Critchlow 2003, Clav- Lacroix Z, Critchlow T, editors. 2003. Bioinformatics: erie and Notredame 2003, Baxevanis and Ouellette managing scientifi c data. San Francisco, Calif. (USA): 2005). For rice researchers with a deeper interest in Morgan Kaufman Publishers. Mount DW. 2001. Bioinformatics: sequence and genome bioinformatics, there are a number of professional analysis. Cold Spring Harbor, N.Y. (USA): Cold Spring organizations to contact: globally, the International Harbor Laboratory Press. McLaren CG, Bruskiewich RM, Portugal AM, Cosico AB. 2005. The International Rice Information System (IRIS): "    #     a platform for meta-analysis of rice crop data. Plant   (    ' Physiol. 139:637-642.  POC (The Plant Ontology Consortium). 2002. Plant Ontology       ! &          Consortium and plant ontologies. Comparative        Functional Genomics 3(2):137-142. Wilkinson M, Schoof H, Ernst R, Haase D. 2005. BioMOBY successfully integrates distributed heterogenous "     $%  #         )   * bioinformatics web services: the PlaNet exemplar case.                       Plant Physiol. 138:1-13. Wu J, Wu C, Lei C, Baraoidan M, Boredos A, Madamba RS, Ramos-Pamplona M, Mauleon R, Portugal A, Ulat V, (        Bruskiewich R, Wang GL, Leach JE, Khush G, Leung  '       #  +  %             H. 2005. Chemical- and irradiation-induced mutants of indica rice IR64 for forward and reverse genetics. Plant Fig. 4. Research agenda of the Generation Challenge Programme. Mol. Biol. 59:85-97. 10CIMMYT is the International Maize and Wheat Improvement Center located in Mexico. In January 2006, the biometrics, crop information, and bioinformatics teams across both institutes were merged into a single “Crop Research Informatics Laboratory” (CRIL) spanning crop information management and comparative biology research in rice, maize, and wheat. 12 June 2006 Genetic resources Dhanrasi, a new lowland rice variety with Oryza rufi pogon genes for improving yield potential and resistance to biotic stresses T. Ram, Directorate of Rice Research, Rajendranagar (DRR), Hyderabad; N.D. Majumder, Indian Institute of Pulses Research, Kanpur; and B. Mishra, DRR, Rajendranagar, Hyderabad 500030, India E- mail: tilathooram@yahoo.co.in Rice production in the rainfed in Moirang (Manipur, India). The plant height, number of tillers shallow lowlands in the eastern O. rufi pogon accession, which is plant–1, panicle length, number of region and the favorable shallow resistant to blast and tungro and grains panicle–1, and grain yield lowlands in the southern region moderately resistant to bacterial plant–1. of India has, for a long time, re- blight, was crossed to high-yield- In the F5 generation, 32 lines mained stagnant. The potential ing, medium-duration breeding with better yield potential were of high-yielding varieties is not line B32-Sel-4. The F1 was crossed evaluated along with their in- fully realized. Several breeding with another high-yielding, late- dica parents B32-Sel-4 and B127. lines are being evaluated every duration line, B127. In the F2 They were screened for yield year in these ecosystems in trials population, 50 plants of B32-Sel- and for blast and bacterial blight organized under the All India Co- 4/O. rufi pogon//B127 with better resistance under natural and ar- ordinated Rice Improvement Pro- agronomic traits were selected tifi cial infection. Eight lines were gram (AICRIP). When compared and intermated to develop 25 found to outyield both parents, with national checks Salivahana crosses. The selection against by 10.2–21.4% in the preliminary and Pranava, none could qualify weedy traits was done in the F1 yield trial. C11-A-41 yielded the for release in favorable shallow and F2 populations derived from highest (6.48 t ha–1) and recorded lowlands in the southern region. intermating. Similarly, a second a yield superiority of 38.2% and However, in the rainfed shallow cycle of intermating in the result- 21.4% over B32-Sel-4 and B127, lowlands of the eastern region, ing F2 population was followed. respectively. The main agronomic CR1002 (1992) and Pooja (1999) Single-plant pedigree selection characteristics of the parents and were released for cultivation. was followed after the second Dhanrasi are given in Table 1. This shows that yield improve- intermating cycle, considering The four lines with superior yield ment per se of varieties bred for these ecosystems, especially in Table 1. Important traits introgressed from O. rufi pogon Griff into Dhanrasi (C11-A-41). favorable shallow lowlands, is Trait Parents Dhanrasi limited, though improvement B32-Sel-4 B127 O. rufi pogon was considerable in quality and pest resistance as refl ected by the Yield trait Plant height (cm) 90–100 105–110 135–145 105–110 release of several varieties at the Days to 50% fl owering 95 ± 5.2 100 ± 4.5 126 ± 6.5 117 ± 3.9 state level. Panicles plant–1 (no.) 10–12 8–12 20–27 12–14 Dhanrasi (C11-A-41) was Grains panicle–1 (no.) 136 ± 12.3 145 ± 10.6 40 ± 15.2 210 ± 14.8 1,000-grain weight (g) 21.6 23.8 24.8 22.5 released in 2002 for cultivation Grain type Long slender Short bold Short bold Short bold in the rainfed and favorable shal- Grain yield (t ha–1) 4.7 5.3 – 6.5 low lowlands in southern India, CD at 5% = 0.23 Reaction to diseases and insect pestsa for the states of Andhra Pradesh, Artifi cial screening Tamil Nadu, Karnataka, and Blast S S Immune R Maharashtra. It was developed Bacterial blight S S MR MR by introgressing genes for yield Sheath blight S S MR MR Rice tungro disease S S R MR components from one of the Natural fi eld screening Oryza rufipogon accessions col- Stem borer S S – MR lected from the submerged areas aR = resistant, MR = moderately resistant, S = susceptible, – = not evaluated. IRRN 31.1 13 were evaluated under AICRIP Dhanrasi was also evaluated na by 10.36%, and Pooja by 24.6%. auspices in 1996, 1997, 1998, and with several newly bred cultures, Maximum yield was 6.58 t ha–1 in 1999. Yield comparisons were national check Swarna, and n ewly 1996, 5.63 t ha–1 in 1997, 7.31 t ha–1 made, involving the newly bred released variety Pooja in the in 1998, and 6.10 t ha–1 in 1999. high-yielding cultures, national eastern and western regions of Besides its high yield potential, checks (Salivahana and Pranava), the country under rainfed Dhanrasi has also introgressed the most popular variety Swarna, shallow lowland conditions. It genes from O. rufi pogon for re- and the latest released Pooja, in showed a yield superiority of sistance to blast and moderate four states of the southern region 11.0% and 38.2% over Pooja and resistance to tungro and bacte- and two states in the eastern re- 4.3% and 8.8% over the highest rial blight. gion. The same trial also screened yielding check in Orissa and Considering its higher yield for reaction to insect pests and Bihar, respectively. In Maharash- potential, disease and pest re- diseases. tra, it out yielded check variety sistance, and very stable yield, In multilocation testing un- Salivahana and Swarna, by 3.8% Dhanrasi was released for culti- der AICRIP in irrigated me- and 22.5%, respectively. vation in Andhra Pradesh, Tamil dium land, Dhanrasi (IET15358) In overall yield performance, Nadu, Karnataka, and Maharash- yielded 5.28 t ha–1 in 1996, 13.3% Dhanrasi outyielded Salivahana tra in 2002-03. and 2.5% higher than the yield by 7.4%, Pranava by 9.24%, Swar- national checks Pranava and Salivahana, respectively. It was Table 2. Yield performance of Dhanrasi (C11-A-41) in rainfed and favorable shallow lowland superior to the highest yielding ecosystems in different states under multilocation (AICRIP) testing. check by 7.8% in Tamil Nadu, Grain yield (t ha–1) Percent yield 20.1% in Karnataka, and was on State increase over a par in Andhra Pradesh (Table Year of Locations Dhanrasi N ational chec k Swarna Best check Swarna 2). Dhanrasi was evaluated at testing (no.) (IET15358) Salivahana Pravana seven locations in 1997, ranking Favorable shallow lowland fi rst in overall yield (4.6 t ha–1). Andhra Pradesh 1996 2 6.2 6.1 6.2 – 0.8 – 1997 3 4.5 4.0 – 4.2 11.9 5.4 This was 26.5% and 14.11% higher 1998 2 5.8 4.9 4.8 – 18.6 – than the yield of Salivahana and 1999 1 5.1 4.7 – 3.2 8.7 62.0 Swarna, respectively. In Andhra Mean 5.4 5.0 5.5 3.7 Pradesh and Tamil Nadu, the Tamil Nadu 1996 2 5.5 5.1 4.1 – 7.8 – 1997 2 5.0 3.8 – 4.3 32.9 13.5 yield superiority of Dhanrasi 1998 2 4.6 5.7 5.3 – –18.9 – over Salivahana was 11.7% and 1999 2 5.1 5.0 – 4.9 1.8 9.3 32.9% and 5.4% and 13.5% over Mean 5.1 4.9 4.7 4.6 Karnataka 1996 3 4.5 3.8 3.5 – 20.1 – Swarna, respectively. In 1998, 1998 3 4.3 3.3 3.7 3.6 16.1 21.3 this variety was evaluated at 10 1999 2 5.0 4.5 – 4.2 11.7 19.7 locations, along with checks and Mean 4.6 3.9 3.6 3.9 Rainfed shallow lowland other cultures, and it registered Maharashtra 1998 3 3.5 3.2 3.5 – 0.3 – a mean yield of 4.4 t ha–1, with 1999 3 3.6 3.5 – 2.9 3.8 22.5 5.4% and 5.3% yield superiority Mean 3.5 3.3 3.5 2.9 over Salivahana and Pravana, re- Orissa 1999 2 3.9 3.7 3.4 3.5 (Pooja) 4.3 11.0 Bihar 1999 4.8 4.4 4.0 3.5 (Pooja) 8.8 38.2 spectively. It recorded the highest yield (7.3 t ha–1) at Maruteru. In Andhra Pradesh and Karnataka, it showed 18.6% and 16.7% higher yield, respectively, than the best check Salivahana. In 1999, it had 8.7% higher yield than Saliva- hana, 6.2% higher yield than Swarna in Andhra Pradesh, and 11.7% and 19.7% over Salivahana and Swarna, respectively, in Kar- nataka (Table 2). 14 June 2006 NDR2026: a new rice variety released for mid-early irrigated areas of Uttar Pradesh, India J.L. Dwivedi, R.S. Verma, S.P. Giri, A.K. Tripathi, and R.N. Vishwakarma, Crop Research Station, Masodha, Narendra Deva University of Agriculture and Technology, Faizabad 224133, Uttar Pradesh, India In irrigated areas in Uttar Pradesh, sess the yield performance in high milling recovery (67%). Its the rice-wheat and rice-potato local/station trials, the culture long slender grains (6.71 mm cropping patterns are most com- was nominated in the All-India length, 2.05 cm breadth, and L/B mon. Early-maturing (110–120 d) Coordinated Rice Improvement of 3.27) make it more attractive. rice varieties are in great demand Programme (AICRIP) during the In the state adaptive trials and so are those with high yield 1995 wet season (WS). The per- during 1999-2000 WS, NDR2026 potential and resistance to preva- formance of NDR2026 and other consistently outyielded check va- lent pests and diseases. There are cultures during the 1995-97 WS rieties in different regions (Table limited releases (Narendra 80 and is presented in Table 1. NDR2026 2). The average yield of NDR2026 Saket 4) of this mid-early irrigated consistently outyielded check va- was 3.9 t ha–1, higher than that of group. These varieties are grown rieties for 3 y. It is 90–95 cm tall, the highest yielding check variety, to increase the overall productiv- produces 9–14 tillers plant–1 with Narendra 80 (3.0 t ha–1). The aver- ity of such areas. Released by the semicompact panicle, is awnless, age yield advantage was about State Variety Release Committee has 1,000-grain weight of 23 g, 22%. This variety is moderately of Uttar Pradesh in October 2004, and matures in 110–115 d. It has resistant to brown spot, sheath NDR2026 (IET14998) is one of the new additions in the mid-early Table 1. Yields (t ha–1) of NDR2026 and check varieties, advanced variety triala-irrigated group. mid-early, 1995-97 wet seasons. This variety was developed Year Locations NDR2026 Checks through a three-way cross—SIPI (no.) Ratha Vikas NDR80 632-63/Chainung Sen yu 47// (national) (national) (local) Taichung Sen 12. The breeding 1995 WS 7 3.6 2.6 2.7 3.2 material came from IRRI under 1996 WS 10 4.3 3.8 3.7 4.0 an institutional collaborative 1997 WS 11 4.0 3.8 3.0 3.6 Mean program. Single-plant selection percentage yield 28 4.0 3.4 3.2 3.6 to identify varieties with the advantage over checks desirable trait of mid-early ma- 1995 +40.26 +30.70 +12.35 1996 +15.38 +19.14 +10.57 turity was made and the pedigree 1997 +6.50 +32.38 +12.07 breeding method was applied Percentage advantage over 3-y means +18.34 +26.72 +11.74 in developing NDR2026. To as- aConducted in adaptability zone 2: Uttar Pradesh, Madhya Pradesh, and Assam. Table 2. Comparative yield performance (t ha–1) of NDR2026 in adaptive trials at the Regional Agriculture Testing and Demonstration Stations (RATDS), 1999-2000 wet seasons.a Cen tral Bundel khand region Tarai region C ulture Eastern region Western region reg ion (northern (southern Varanasi Azam garh Barabanki Meerut Bar eilly Mathura Har doi Uttar Pradesh) Uttar Pradesh) State mean Jhansi Haldwani NDR2026 4.3 3.5 4.9 5.4 2.9 4.3 1.9 3.4 3.8 3.9 HUR1006 – 2.8 3.8 3.3 3.0 – – 2.6 3.2 3.1 Narendra 80 3.7 – – 3.2 2.5 – 2.3 – – 3.0 (check) Saket 4 3.4 2.9 4.1 3.5 2.7 – 1.5 2.5 3.1 2.9 aSource: RATDS combined report for 1999-2000 WS. IRRN 31.1 15 blight, and sheath rot under natu- rigated conditions and may be excellent grain quality. This vari- ral fi eld conditions. It has some best for use in rice-wheat and rice- ety will be a good replacement for degree of tolerance for stem borer, potato cropping systems because Narendra 80, which was released whorl maggot, and leaffolder. To of its consistent yield superiority, in the early eighties. validate its yield performance, disease and pest resistance, and NDR2026 was extensively evalu- ated in farmers’ fi elds in different Table 3. Yield performance of NDR2026 in farmers’ fi elds in east- districts of eastern Uttar Pradesh ern Uttar Pradesh, 2000 and 2001 wet seasons. (Faizabad, Sultanpur, Barabanki, District Locations Yield (t ha–1) Gonda, and Ambedkarnagar) (no .) NDR2026 Narendra 80 Saket 4 during 2000-01 WS (Table 3). It re- corded a signifi cantly stable yield Ambedkarnagar 5 5.4 4.7 4.4 advantage over check varieties Faizabad 6 5.4 4.8 4.5 Gonda 3 5.2 4.8 4.6 Narendra 80 and Saket 4. Sultanpur 5 4.9 4.5 4.6 T h e r e s u l t s s h o w t h a t Barabanki 3 5.1 4.8 4.3 NDR2026 is well suited for ir- Mean 22 5.2 4.7 4.5 CSR23: a new salt-tolerant rice variety for India R.K. Singh and G.B. Gregorio, Plant Breeding, Genetics, and Biotechnology Division, IRRI, Philippines; and B. Mishra, Directorate of Rice Research, Hyderabad 500030, India A vast area of sodic soils in In- salinity regime is highly variable. Plant Breeding, Genetics, and dia lies in the provinces of Uttar High water depth submerges Biotechnology Division, IRRI, Pradesh and Haryana, whereas the crop during its growth and Philippines. The breeding ma- coastal saline soils are spread this ranges from a few days to a terials in the form of advanced throughout the coastline of India few weeks. Farmers need a high- bulk populations (ABPs) were running through Maharasthra, yielding, salt-tolerant variety received in 1989 by the Central Gujarat, Kerala, Tamil Nadu, with strong culm and intermedi- Soil Salinity Research Institute, West Bengal, and Pondicherry. ate stature, which can enable it to Karnal, from IRRI under the Most of these areas lie barren or survive water stagnation as well. ICAR–IRRI Collaborative Re- produce low yields. However, Unfortunately, most of the variet- search Project on “Germplasm these same areas can be trans- ies in such areas are traditional improvement for saline soils in formed into arable and highly types with poor grain quality rice.” This included ABP no. 085 productive land if suitable salt- and low yielding ability due to (IR52713-2B-8-2B), selection from tolerant crop varieties are avail- salt sensitivity and susceptibility which consequently resulted in able. The rice crop is the obvious to lodging. These areas require the development of CSR23. All choice in coastal and sodic areas a rice variety with intermediate the ABPs were screened under as it can withstand standing wa- stature and medium to fi ne grain artifi cially created stress environ- ter and also sustain salt stress. qualities, and that is nonlodging, ments in concrete microplots and The major problem in alkaline nonshattering, high-yielding, natural hot spots. soils is the exchangeable sodium and fertilizer-responsive, and has Variety CSR23 was entered percentage (ESP) that raises soil high salt tolerance. In this regard, in the All-India Coordinated Rice pH from more than 8.5 to more CSR23 is a good candidate. Improvement Program through than 10.0. This consequently ex- CSR23 (IET13769) is a high- a national salinity trial. It was erts high sodicity stress through- yielding, salt-tolerant variety tested under the Saline Alkaline out the crop’s growth period with medium slender grains. Tolerant Varietal Trial (SATVT) and affects nutrient availability. It is derived from a three-way in 1994 as CSR-89IR-5 (IET13769) However, in coastal saline areas, cross (IR64//IR4630-22-2-5-1- and evaluation was repeated in stress varies with crop growth as 3/IR9764-45-2-2) made in the 1995, 1996, and 1997. Later, agro- 16 June 2006 nomic comparison with standard       checks was done to assess yield-  ing ability under varying nitrogen  regimes. Based on its superiority  shown over the years, this variety  was identifi ed in 2003 and, upon  recommendation of the Central  Sub-Committee on Crop Stan-  dards, Notifi cation, and Release              of Varieties, was released in 2004     by the Ministry of Agriculture, Fig. 1. Summary mean yield performance of CSR23 in comparison Government of India, for alkaline with check varieties (1994-97). soils of Uttar Pradesh and Hary- ana and the coastal saline soils Grain yield evaluation of CSR23 under coordinated trials (1994-97). of Maharasthra, Gujarat, Tamil Year Trials CSR23 High-yielding Nadu, Kerala, and West Bengal. A Salt-tolerant checks (no.) check sister line (IR52713-2B-8-2B-1-2), CSR10 Vyttila 4 Panvel 2 Usar 1 Jaya derived from the same cross, was Mean yield 1994 11 3761 2,971 – – – 2,991 also released in the Philippines as (kg ha–1) 1995 10 3027 2,398 2,748 – – 3,302 PSBRc 88 in 1999. across 1996 6 3342 2,428 1,758 2,203 1,493 1,638 locations 1997 10 2973 2,214 2,714 – – 2,614 In the coordinated trials over Mean 3297 2,539 2,519 2,203 1,493 2,775 the years, CSR23 has shown a Yield 1994 +26.6 – – – +25.7 consistent increase over all the advantage 1995 +26.2 +10.1 – – –8.3 over checks 1996 +37.6 +90.1 +51.7 +124.8 +104.0 checks and qualifying varieties (%) 1997 +34.3 +9.5 – – +13.8 throughout the years of testing Mean +29.9 +30.9 +49.7 +120.8 +18.8 for salt tolerance—1994 to 1997. It recorded a yield increase over all checks by as much as 125% over Usar 1, 90% over Vyttila 4, 104% over Jaya, 51% over Panvel 1, and 37% over CSR10. It was convincingly superior to all the checks (Fig. 1, see table). CSR23 has intermediate plant stature (115–120 cm) with fully exserted panicles, is awnless, has purple stigma, and takes 100–105 days to 50% fl owering. Its grain is the medium slender type with 5.8 mm length and a length-breadth ratio of 2.8. It is best-suited to meet most of the requirements in the problem areas. It can with- stand the sodicity stress up to pH2 ~ 10.0 and salinity (ECe) up to 8 dS m–1. It has high yield (even on nonstressed or moderately stressed soils) and a high degree of salt tolerance. Field screenings showed its moderate resistance to blast, neck blast, and brown spot. Besides having other desirable agronomic traits, it was found Fig. 2. Salt-tolerant CSR23. IRRN 31.1 17 resistant to leaffolder and moder- Land Development Corporation the reclamation of more than ately resistant to gall midge bio- (UPLDC) in Lucknow c onducted 140,000 ha of sodic land. The av- type 5. CSR23 has intermediate adaptive “on-farm” trials in salt- erage grain yield of this variety, tissue tolerance, better K+ uptake, affected fi elds at 19 locations in recorded in station trials in vari- and Na+ exclusion ability, desir- Uttar Pradesh and got a 4.5 t ha–1 ous years, was 6.5–7.0 t ha–1 under able attributes of a salt-tolerant average yield (large-plot basis). normal soil conditions. These variety. The variety has become popular results demonstrate the yield sta- There is a great demand for and there was a great demand bility of the new variety for saline this variety in Uttar Pradesh and for its seed from agencies such and nonsaline fi eld conditions. other states. The Uttar Pradesh as UPLDC, which has targeted Rajendra Sweta, a new high-yielding quality rice variety for Bihar’s irrigated ecosystem V.N. Sahai, Agricultural Research Institute, Mithapur, Patna 800001, and R.C. Chaudhary, Participatory Rural Development Foundation, Shahbazganj, Jungle Salikram, Gorakhpur 273014, India After the introduction of high- Rajendra Sweta was tested in strations, its average yield was 4.9 yielding rice varieties in the 1960s, 55 farmers’ fi elds in Bihar from t ha–1, while that of the check was breeding programs were started 2001 to 2003. It had an average 3.9 t ha–1. Yield consistency and in India to develop high-yield- yield of 4.7 t ha–1 and a 10% yield wide adaptability under varying ing semidwarf lines. One decade advantage over the local check agroclimatic conditions are some later, research efforts focused on varieties. In 18 front-line demon- of the merits of this new variety. developing high-yielding quality rice. Both customers and farmers Table 1. Morphological and grain quality characteristics of Rajendra Sweta and Pusa appreciate fi ne-grained quality rice Basmati 1. as it fetches a high market price. Characteristic Rajendra Sweta Pusa Basmati 1 Rajendra Sweta (RAU710-99- Plant height (cm) 85–90 85–90 22) was developed from the cross Duration (d) 135–140 130–135 Plant type Erect, compact Erect, compact Sita/Pusa Basmati-1//Katarni, Tillers hill–1 (no.) 10–15 8–10 varieties with superior grain qual- Panicle type Compact Compact Panicle exsertion Compact Compact ity and high yield potential. The Awn Awnless Awned State Variety Release Committee Hulling (%) 79.2 80.0 Milling (%) 70.0 69.6 of Bihar approved the release of Head rice recovery (%) 66.0 57.3 Rajendra Sweta for the irrigated Kernel length (mm) 5.03 7.25 ecosystem in 2004. Kernel breadth (mm) 1.65 1.8 Length-breadth ratio 3.04 4.02 Rajendra Sweta is a photope- Grain type Medium and slender Long and slender riod-insensitive, medium-matur- Grain chalkiness Occasionally present Occasionally present Volume expansion ratio 4.8 5.4 ing, semidwarf variety with good Water uptake (mL) 250 375 grain quality (Table 1). The vari- Alkali spreading value 4.0 7.0 Amylose content (mm) 23.6 24.8 ety was tested in breeding trials Gel consistency 63 63 in Bihar from 2000 to 2003. It gave a higher average yield (3.5 t ha–1) Table 2. Performance of Rajendra Sweta in breeding trials at four sites in Bihar, India, than did the checks Pusa Basmati 2000-03. 1 (2.3 t ha–1) and Sugandha (2.7 t Av grain yield (t ha–1) Increase ha–1) (Table 2). In a nutrient-use Entry Patna Bikramganj Pusa Sabour Mean over check effi ciency trial, Rajendra Sweta (%) gave the highest grain yield at Rajendra Sweta 4.2 4.4 3.3 1.9 3.5 – 80-40-20 kg NPK ha–1 nutrient Pusa Basmati 1 (check) 2.4 3.1 2.0 1.8 2.3 52.2 Sugandha (check) 2.7 2.8 3.2 2.0 2.7 29.6 level (Table 3). 18 June 2006 Table 3. Performance of Rajendra Sweta in nutrient-use effi ciency trials in Bihar, India, 2002-03. Av grain yield (t ha–1) Increase over Entry N1 N2 N3 Mean check (40-40-20 kg (80-40-20 kg (120-40-20 kg (%) NPK ha–1) NPK ha–1) NPK ha–1) Patna Rajendra Sweta 3.4 4.5 4.2 4.0 – Pusa Basmati 1 (check) 2.5 3.2 2.9 2.9 38.0 Bikramganj Rajendra Sweta 2.5 4.6 4.8 4.0 – Pusa Basmati 1 (check) 2.5 3.8 3.9 3.3 21.2 Pusa Rajendra Sweta 2.8 3.4 2.8 3.0 – Pusa Basmati 1 (check) 2.3 2.3 2.2 2.3 30.4 Karjat 6, a new, superfi ne medium-duration rice variety in Maharashtra, India B.V. Ingale, B.D. Waghmode, V.V. Dalvi, and A.P. Rewale, Regional Agricultural Research Station, Karjat 410201, District Raigad, Maharashtra, India E-mail: hybrid@vsnl.net Rice is grown on 1.5 million ha in recovery. Its other grain charac- The variety recorded a 5.7% Maharashtra State, India. Of the teristics are given in Table 1. increase in yield over the check total area under rice, about 56% Karjat 6 recorded an 8.6% and in the All India Coordinated is planted to fi ne and superfi ne 5.3% yield advantage over check trial conducted at 22 locations in varieties; the rest is under coarse- Mahsuri in initial and advanced the country during 2004 kharif. grained varieties. Early, medium- station trials conducted in 2000 A yield increase of 23.7% was late, and late varieties, respec- and 2001 kharif, respectively observed in 19 adaptive trials tively, occupy about 40%, 40%, (Table 2). It has given a 10.3% and conducted in farmers’ fi elds at and 20% of the area in the state. 33.3% increase in grain yield over the same time (Table 2). Karjat Because fi ne-grained varieties are the check in the state coordinated 6 gave a 28.9% increase in grain preferred, the Karjat rice research trials in 2002 and 2003 kharif, yield with the application of 100 station developed Karjat 4, an respectively, at nine locations in kg N ha–1 over the 50-kg treatment early-maturing variety (115–120 the state. in 2004 kharif. It has recorded d), and Karjat 6, a medium-dura- tion (130–135 d) line suitable to Table 1. Grain characteristics of Karjat 6 compared with Samba the varied agroecological condi- Mahsuri. tions in the state. Characteristic Karjat 6 Samba Mahsuri Karjat 6 (KJT-12-6-25-9-13-50- (BPT5204) 13) was developed through the Milling (%) 68.1 70.1 Head rice recovery (%) 65.0 67.5 pedigree method. It involved a Kernel length (mm) 5.51 4.99 cross of Heera and Karjat 4. Rec- Kernel breadth (mm) 1.80 1.79 ommended for commercial cul- Length-breadth ratio 3.06 2.78 Volume expansion ratio 5.5 4.7 tivation in Maharashtra in 2005, Water uptake (mL) 210 170 Karjat 6 is a semidwarf (95–100 Kernel length after cooking (mm) 8.1 9.2 cm) variety having short, slender Elongation ratio 1.70 1.84 grains, 1,000-kernel weight of Alkali spreading value 4.5 5.0 Amylose content (%) 25.43 25.25 13.30 g, and average grain yield Gel consistency (mm) 43 43 of 3.5–4.0 t ha–1. The variety has Grain type Short, slender Medium, slender 68.1% milling and 65% head rice Grain chalkiness Absent Absent IRRN 31.1 19 a 10.5% increase in grain yield Table 2. Yield performance of Karjat 6 in different trials and demonstrations conducted at over check Karjat 4 in front-line different locations. demonstrations during the 2004- Av grain yield Increase 05 rabi season. Screening trials Trial (t ha–1) over check Karjat 6 Check (%) showed that it is resistant to leaf- Initial variety trial (station), 2000 3.8 3.5 8.6 folder, stem borer, and neck blast. Advanced variety trial (station), 2001 4.0 3.8 5.3 Karjat 6 will become popular in State-coordinated trial (initial) (9 locations), 2002 3.2 2.9 10.3 the state in view of its superior State-coordinated trial (advanced) (9 locations), 2003 3.6 2.7 33.3 AICRIP trial-SG (22 locations), 2004 3.7 3.5 5.7 grain type, high yield potential, Adaptive trial (19 locations), 2004 4.9 3.8 23.7 and good quality traits. Agronomic trial, 2004 4.0 3.2 28.9 Field demonstration, 2004-05 6.3 5.7 10.5 Av 4.18 3.63 15.2 Sahyadri 2, an early rice hybrid for Maharashtra State in India B.V. Ingale, Regional Agricultural Research Station (RARS), Karjat, District Raigad; N.D. Jambhale, Dr. Balasaheb Sawant Konkan Krishi Vidyapeeth, District Ratnagiri; B.D. Waghmode and V.V. Dalvi,* RARS, Karjat, District Raigad (*current address: RARS, Karjat 410201, Maharashtra, India) E-mail: hybrid@vsnl.net In India, rice is predominantly able early-duration rice hybrids may contribute to higher rice grown on 1.4 million ha of tra- with desirable characteristics to production and productivity ditional and 0.9 million ha of increase rice productivity. (Tables 1–3). nontraditional areas in the state Karjat rice hybrid 3 (KJTRH of Maharashtra. Average pro- 3) was developed at ductivity is 1.7 t ha–1. A total of RARS and was re- Table 1. Morphological and grain quality characteristics of 53 high-yielding rice varieties leased as Sahyadri Sahyadri 2. (HYVs) have been released for 2 for commercial Characteristic commercial cultivation in the cultivation in Ma- Duration (d) 115–120 state for various agroecological harashtra in 2004. Plant height (cm) 114–119 conditions. The productivity of Seed production Yield (t ha–1) 6.0–6.5 (potential, 12.1) rice nevertheless remained stag- of Sahyadri 2 was Tillers hill–1 (no.) 15–20 Grains panicle–1 (no.) 175–200 nant during the last decade. The easier because of Panicle length (cm) 25.5 adoption of rice hybrids, along less staggered fl ow- 1,000-grain weight (g) 23.5 with proper crop management ering between pa- Milling (%) 70.2 practices, is certainly an alterna- rental female and Head rice recovery (%) 56.0 Kernel length (mm) 6.63 tive for increasing productivity male lines of the Kernel breadth (mm) 2.18 in the state. The RARS in Karjat, hybrid. Therefore, Length-breadth ratio 3.04 District Raigad, has identified ample seed pro- Grain type Long and slender Alkali value 6.0 and released the first rice hy- duction is possible Amylose content (%) 20.89 brid, Sahyadri, for commercial on a large scale in Grain chalkiness Occasionally present cultivation. It has medium-late suitable areas to Reaction to diseases/insect pests False smut Highly resistant growth duration and a high yield meet demand for Bacterial blight Resistant potential, (6.5–7.5 t ha–1). The area seed. Blast Resistant under hybrid rice is increasing The new hybrid Sheath rot Moderately resistant gradually in the state, but nearly meets farmers’ re- Brown spot Moderately resistant Rice tungro virus Moderately resistant 60% is planted to early-dura- quirements in both Stem borer Moderately resistant tion rice varieties. Efforts were state and country Brown planthopper Moderately resistant therefore made to develop suit- and its adoption 20 June 2006 Table 2. Yield performance of Sahyadri 2 in the All India Coordinated Trials, by region, 2001-02. Season/year Av yields (t ha–1) in different regionsa % mean yield advantage over different checksb RM2 RM3 RM4 RM5 Overall National Regional Local mean checkb checkc checkd 2001 kharif 6.6 4.3 6.0 6.5 5.8 21.6 22.4 8.3 2002 kharif 6.1 3.1 6.2 5.1 5.0 27.2 28.8 8.9 Av 6.3 4.1 6.1 5.8 5.4 24.4 25.6 8.6 aRM2: Delhi, Uttaranchal, Punjab, Haryana, Jammu plains, and Rajasthan; RM3: Orissa, Bihar, Jharkand, West Bengal, Uttar Pradesh, Chhattisgarh, Madhya Pradesh, Tripura, Manipur, Meghalaya, and Assam; RM4: Maharashtra and Gujarat; RM5: Andaman, Nicomar, Andhra Pradesh, Tamil Nadu, Kerala, Karnataka, and Pondicherry. bAnnada (2001) and Govinda (2002). cTulsi. dKarjat 3. Table 3. Yield performance of Sahyadri 2 under different trials and demonstrations in Maharashtra State. Season and Av yield Advantage over Type of trial year (t ha–1) Ratna (%) Sahyadri 2 Ratna (check) Observational yield trial Kharif, 2001 5.6 4.1 37.1 Station trial Kharif, 2001 5.6 4.1 35.5 State-coordinated trials Kharif, 2001 4.7 4.3 11.9 State-coordinated trials Kharif, 2003 5.5 4.5 20.1 State-coordinated trials Kharif, 2004 5.8 4.3 36.6 Adaptive trials in farmers’ fi elds (21 sites) Kharif, 2003-04 7.8 6.1 27.1 Demonstration Kharif, 2003-04 8.4 6.2 34.7 Agronomic trial Kharif, 2004 5.3 3.8 36.6 Adaptive trials in farmers’ fi elds (40 sites) Kharif, 2004 6.4 4.1 35.2 Av 6.1 4.6 30.5 IRRN 31.1 21 Pest science & management Analysis of Pyricularia grisea populations from three different blast epidemics D. Mishra, U.D. Singh, A.B. Dash, J.N. Reddy, and R. Sridhar, Central Rice Research Institute, Cuttack 753006, India; M.L.C. George, C.M. Vera Cruz, M.A. Bernardo, and H. Leung, International Rice Research Institute, Los Baños, Philippines; and R. Sridhar, International Institute of Biotechnology and Toxicology, Padappai 601301, Kancheepuram District, Tamil Nadu, India In spite of a great deal of research rable with that determined with was indicated by this software in on the blast pathogen (Pyricularia MGR586 restriction fragment a computer for each isolate. The grisea (Cooke) Sacc., an anamorph length polymorphism lineages binary matrix indicating presence of Magnaporthe grisea (T.T. He- (George et al 1998). Our analysis or absence of the bands was used bert) Yaegashi & Udegawa) of clearly brought out the popula- to construct a matrix of similari- rice and the disease itself, blast tion structure of the pathogen ties between all pairs of isolates remains a serious constraint to in the three blast epidemics and based on Dice’s coeffi cient (F = rice production in areas with showed the difference between 2Nxy + Ny), where Nxy is the conducive environments and traditional and modern rice cul- total number of bands observed where susceptible cultivars are tivars. for that pair of isolates. grown. There has been no effort to Three sets of monoconidial Fingerprint patterns of P. analyze the pathogen populations isolates of the pathogen P. grisea grisea subpopulations from Banki that occurred during the blast were obtained from infected (29 isolates), Dhenkanal (31 iso- epidemics in India. Three of these leaf/neck blast samples collected lates), and Berhampur (43 iso- epidemics occurred in the state of from farmers’ fi elds during the lates) revealed the presence of Orissa in the past decade. The fi rst epidemics. Totaling 103, these 23, 24, and 43 haplotypes, re- epidemic was in Banki, Cuttack were stored on fi lter paper bits spectively. The Banki popula- District, in the 1997 wet season, at –20 °C and were used for DNA tion was differentiated into three during which traditional rice cul- fi ngerprinting (Table 1). Genomic lineages of the pathogen at 60% tivars Laghubhutia and Golabon- DNA was extracted following similarity (Fig. 1a). Two of the di were heavily infected by neck the procedure of Murray and lineages detected were obtained blast. The second epidemic, in the Thompson (1980) for plant DNA from a single cultivar, Golabondi, wet season of 2000 in Dhenkanal, with modifi cations for mini-scale whereas the third lineage was ob- Dhenkanal District, involved preparation as described by Scott tained from the other cultivar, La- traditional cultivar Latamohu et al (1993). Polymerase chain ghubhutia. However, one of the and high-yielding semidwarf reaction with primers Pot2-1 (5’ isolates obtained from the former Dhala Heera. They got severely CGGAAGCCCTAAAGCTGTTT cultivar belonged to the third lin- infected by leaf blast. During the 3’) and Pot2-2 (5’ CCCTCATTC- eage. The Dhenkanal population third epidemic (2002 wet season, GTCACACGTTC 3’) and visu- obtained from two rice cultivars Ganjam District), high-yielding alization of the DNA fragments (Dhala Heera and Latamohu) variety Swarna grown in farm- were as described previously was grouped into four lineages ers’ fi elds was severely infected (George et al 1998). The gel im- of the blast pathogen (Fig. 1b). All by leaf blast. ages were photographed using the isolates belonging to the fi rst A repetitive element-based a gel documentation system three lineages were obtained from polymerase chain reaction (rep- equipped with Bio-Capt software Dhala Heera, which is a modern PCR), with primer sequences (Vilber Lourmat, France). The semidwarf variety, while the iso- from Pot2 (an element found structure of the pathogen popula- lates of the fourth lineage were in approximately 100 copies in tion was analyzed using the Bio- obtained from Latamohu, which the P. grisea genome), provides 1D++ software (Vilber Lourmat, is a traditional rice cultivar. The an effi cient way to monitor the France). For each band position subpopulation of the pathogen population dynamics of the blast between 400 bp and 23 kb, the isolates obtained from the blast pathogen. This method is compa- presence or absence of the band epidemic in Berhampur was dif- 22 June 2006 ferentiated into 12 lineages (Fig.            1c). Interestingly, all the isolates    of the subpopulation of the patho-   gen were obtained from a single   modern rice cultivar, Swarna,   which was the predominant   variety in farmers’ fi elds in this   location. In general, traditional   rice varieties were infected by a      single predominant lineage of   the pathogen during epidemics,    whereas modern rice cultivars   were infected by multiple lineag-    es of the blast pathogen (Fig. 2).       References George MLC, Nelson RJ, Zeigler RS,            Leung H. 1998. Rapid population   analysis of Magnaporthe grisea    with rep-PCR using endogenous   repetitive DNA sequences.  Phytopathology 88:223-229.   Murray MG, Thompson WF. 1980.   Rapid isolation of high molecular   weight plant DNA. Nucleic Acids  Res. 8:4321-4325.    Scott RP, Zeigler RS, Nelson RJ.   1993. A procedure for miniscale   preparation of Pyricularia grisea  DNA. Int. Rice Res. Notes 18(1):   47-48.        Acknowledgments    This study is part of a collaborative    project between IRRI and CRRI (ICAR) and is supported by grants            from the Asian Development Bank   (RETA 5510 and 5667) for the Asian     Rice Biotechnology Network, the    Rockefeller Foundation (2000 FS 088),    and the Indian Council of Agricultural      Research.         Fig. 1. Dendrogram constructed with UPGMA    on the basis of Pot2 repetitive element-based    polymerase chain reaction fi ngerprint data of    Pyricularia grisea for a collection of 29 isolates    from two rice cultivars: Golabondi (isolates:     IAPG 0101–IAPG 0115) and Laghubhutia    (isolates: IAPG 0116–IAPG 0129) grown in   Banki (a); 31 isolates from two rice cultivars:    Latamohu (isolates: IAPG 0130–IAPG 0145)   and Dhala Heera (isolates: IAPG 0146–IAPG   0160) grown in Dhenkanal (b); and 43 isolates    from a single rice cultivar Swarna (isolates:   IAPG 0161–IAPG 0203) grown in Berhampur    (c). Homology level of 60% is marked with broken lines vertically. IRRN 31.1 23 %)% *) +,-          ! " #$% &'%   ( # (  %")%                      Fig. 2. Occurrence of different blast pathogen lineages in three different blast epidemic outbreaks at Banki, Dhenkanal, and Berhampur in the state of Orissa. Isolates of Pyricularia grisea collected from farmers’ fi elds in epidemic regions for comparative study. Site District in Ecosystem Seasona Rice genotypes No. of isolates Orissa Tissue Leaf Neck Total Banki Cuttack Rainfed upland 1997 WS Laghubhutia and Golabondi – 29 29 Dhenkanal Dhenkanal Rainfed upland 2000 WS Latamohu and Dhala Heera 31 – 31 Berhampur Ganjam Rainfed upland 2002 WS Swarna 43 – 43 Total 74 29 103 aWS = wet season. Record of a hyperparasitoid on Pseudogonatopus nudus Perkins (Dryinidae: Chrysidoidea) parasitizing Nilaparvata lugens (Stål) from Asia S. Manickavasagam, A. Prabhu, and R. Kanagarajan, Department of Entomology, Faculty of Agriculture, Annamalai University, Chidambaram, Tamil Nadu, 608002 India E-mail: manikavasagam_gc@sancharnet.in Plant- and leafhoppers of rice are are the most common. The rest of planthopper (BPH) and green well-recognized noxious pests the parasitoids, dryinids, pipun- leafhopper (GLH) nymphs and and severe populations have culids, strepsipterans, and vellids, adults showing the larval sac pro- often caused serious rice yield are unstable but still contribute trusion symptom were collected losses. Many natural enemies to the biological management of during the 2004 Kuruvai crop are reported on these hoppers hoppers. (July-Sep). They were transferred in rice. Among the parasitoids, In a routine attempt to col- to potted plants under green- mymarids and trichogrammatids lect dryinids, parasitized brown house conditions and reared till 24 June 2006 the matured dryinid larvae came through the larval sac until adult and parvus to Echthrogonatopus. out and pupated on the surface emergence. The hyperparasitoid However, no host was recorded of the culm region. Surprisingly, spent nearly 2 d in the larval stage until 2002. Behera et al (2002) from a few pupae of dryinids, in- of dryinid and the remaining have reported E. nigricornis as a stead of dryinid adults emerging, period in the pupal stage. The hyperparasitoid of Goniozus sp. other parasitoids came out. Later, adult took totally 1 min and 55 s (Bethylidae: Hymenoptera) para- these parasitoids were identifi ed from insertion of the ovipositor to sitizing rice leaffolder Cnapha- as Cheiloneurus exitiosus (Per- withdrawal after egg laying. This locrocis medinalis (Guenée) from kins) [Echthrogonatopus n igricornis process was repeated three times India. Guerrieri and Viggiani (Hayat) is a synonym] belonging by the same adult in the same host (2004), in their review of the en- to the family Encyrtidae. It is but at different locations of the cyrtid parasitoids of Dryinidae, a larval-pupal parasitoid. This larval sac. The timings in the sub- have reported the genera Cheilo- hyperparasitoid on dryinid (Pseu- sequent ovipositions were 1 min neurus and Helegonatopus and 31 dogonatopus nudus) Perkins, seems 10 s, 55 s, and 20 s, respectively. species as hyperparasitoids, and to be the fi rst record from Asia. However, it is yet to be confi rmed further synonymized Echthrogo- This encyrtid hyperparasit- whether the encyrtid laid all four natopus with Cheiloneurus, and E. oid was reared in the laboratory eggs during the fi rst insertion or nigricornis with exitiosus. on 50% honey solution and its laid one egg during each insertion This hyperparasitoid may be oviposition behavior and host at different locations of the larval responsible for the reduced ef- preference were studied and pho- sac. The male and female adult fectiveness of dryinids, thereby tographed (Nikon Coolpix 5400 parasitoids survived for 10 and allowing the hopper population using macro-close-up option) on 14 d, respectively. The sex ratio to fl are up and sporadically cause P. nudus (see fi gure). The mated observed was either 1:3 or 2:2. hopperburn. female preferred to oviposit in The type species of Echthrogo- later instars of P. nudus larva natopus, E. exitiosus Perkins, has References through the larval sac. One day been recorded from a dryinid Behera KS, Rao VN, Mathur KC. after parasitization, the matured (Gonatopus sp.) from Austra- 2002. Aspects of the reproductive dryinid larva came out of the lia (Perkins 1906). In India, E. biology of Goniozus sp. (Hym: Beth). a larval parasitoid of rice larval sac and pupated. From a nigricornis (Hayat) was originally leaf folders. J. Appl. Zool. Res. single dryinid pupa, four encyrtid described by Hayat (1980) in the 13(2/3):190-192. parasitoids emerged. genus Metapterencyrtus, but in Guerrieri E, Viggiani G. 2004. A review The total life cycle took about the same paper, Hayat (1980 : of the encyrtid (Hymenoptera: 14 d, starting from egg laying p.645) transferred this species Chalcidoidea) parasitoids of Dryinidae (Hymenoptera: Chrysidoidea) with description of a new species of Cheiloneurus. Syst. Biodiversity 2:305-317. Hayat M. 1980. On Paraclausenia gen. nov., Metapterencyrtus and Neocharitopus from India (Hymenoptera: Encyrtidae). J. Nat. Hist. 14:637-645. Perkins RCL. 1906. Leaf hoppers and their natural enemies (VIII). Bull. Hawiian Sugar Planters’ Assoc. Exp. Stn. (Entomol. Ser.) 1(8):256. Acknowledgments The authors thank Dr. Md. Hayat of Aligarh Muslim University, India, for identifying the hyperparasitoid and also for his critical comments on the manuscript. They are also grateful to Dr. Y. Yamada of Mie Hyperparasitoid, Echthrogonatopus nigricornis (Hayat) parasitizing through the larval sac of University, Japan, who shared technical Pseudogonatopus nudus Perkins on Nilaparvata lugens (Stål). information on dryinids. IRRN 31.1 25 Endo- and ectoparasites of the Philippine rice fi eld rat, Rattus tanezumi Temminck, on PhilRice farms M.M. Antolin, R.C. Joshi, L.S. Sebastian, L.V. Marquez, and U.G. Duque, Philippine Rice Research Institute (PhilRice), Maligaya, Science City of Muñoz, Nueva Ecija 3119, E-mail: rcjoshi@philrice.gov.ph, joshiraviph@yahoo.com, joshiravi0@lycos.com); C.J. Domingo, College of Veterinary Science and Medicine, Central Luzon State University (CLSU), Science City of Muñoz, Nueva Ecija 3120, Philippines The Philippine rice fi eld rat, Rat- with their ectoparasites. Though Six species of endoparasites tus tanezumi Temminck, is one of they have low host specificity, and three species of ectoparasites the principal pre- and postharvest these arthropods can infect hu- infected R. tanezumi on PhilRice pests of rice and other agricultural mans and domestic animals— farms (Table 1). (Voucher speci- crops. This species usually thrives their bites may result in microbial mens, accession numbers 2006-30 in lowland and upland rice fi elds infections or hypersensitive reac- to 37, are deposited in the Parasite but can also be found in or near tions. Collection, College of Veterinary places of human habitation. They In this study, we identi- Medicine, University of the Phil- damage agricultural crops and also fied, according to viscera, the ippines Los Baños, Philippines.) serve as reservoir hosts for diseases endoparasites and ectoparasites The endoparasites were found of certain human and domestic affecting R. tanezumi and de- in the liver, lungs, pulmonary animals caused by helminths, pro- scribed their mode of transmis- arteries, duodenum, and small tozoans, and microbes. sion to humans. The monthly intestines. The ectoparasites, on Many endoparasites infecting prevalence of infected R. tanezumi, the other hand, were detected in the different viscera of R. tan- by sex and endo- and ectoparasite the skin and, in a few cases, in ezumi belong to taxonomic groups species, was also determined. the small intestines because of Nematoda (roundworms), Cesto- Rattus tanezumi collected accidental ingestion. A majority da (tapeworms), and Trematoda from PhilRice rice fi elds, irriga- of the parasites identifi ed were (fl ukes). The more important ones tion systems, and rat burrows zoonotic to humans. The mode are those that are transmissible were brought to the laboratory of transmission varied between to humans. In contrast, there for identification. They were parasites. have been few reports on the ec- sorted according to sex, weight, Nematode infections between toparasites that infest these rats. and sexual maturity. The weight rat sexes were similar, except for These are the mites, ticks, and of male and female rats ranged Angiostrongylus cantonensis (Table fl eas, some of which may serve as from 80 to 150 g and from 100 to 2). In August, A. cantonensis vectors of microbial infections to 150 g, respectively. The ectopara- emerged. The incidence of Nip- humans and domestic animals. sites were collected immediately postrongylus muris was observed Rattus tanezumi is an alterna- after killing the rat. Chloroform to be higher throughout the study tive meat source for the rural folk. was used to kill the ectoparasites period. Rodentolepis spp. (=Hyme- Rat meat is a favorite accompa- on the dead rats. The parasites nolepis spp.), Raillietina garrisoni, niment to alcoholic beverages were combined from the rat into and Taenia taeniaeformis (=Strobi- during drinking sprees. Unknow- a white, enameled pan. The rat’s locercus fasciolaris) infections were ingly, some zoonotic infections internal organs were removed much lower than other endopara- can be transmitted to humans and dissected for microscopic sitic infections. Euparyphium spp. through improperly cooked rat examination of endoparasites. infections were higher than those meat and viscera, accidental Parasite specimens were trans- of cestodes. The kind of food wound contamination with rat ferred into 1.5-mL microtubes sources consumed at a particular urine, or rat bites during handling containing 95% ethanol for stor- time is probably related to infec- and precooking preparations. age and for permanent mounting tions of endoparasites. All R. tan- When rats frequent human after identifi cation. The monthly ezumi samples were infected with abodes, they can contaminate ob- prevalence of infected R. tanezumi Liponyssus bacoti (=Ornithonyssus jects such as clothing and dishes was calculated. bacoti), but few animals had the 26 June 2006 two species of rat louse (Polyplax mestic animals. The best protec- giene with food preparation, and spp. and Hoplopleura spp.). tion is to maintain environmental insect management are equally A majority of the parasites ob- sanitation and to discriminate in important in preventing parasite served in this study are zoonotic the cooking and consumption of transmission cycles. to human beings and infect do- rat meat. Hand washing, good hy- Table 1. Endo- and ectoparasite(s) observed in the organs of R. tanezumi and their mode of transmission to humans, PhilRice, Nueva Ecija, Philippines, June-December 2005. Parasite identifi ed Common name Organ of origin Zoonotic to humans Mode of transmission to humans Taenia taeniaeformis Tapeworm Liver ? Ingestion of raw liver containing viable larvae (=Strobilocercus fasciolaris) Rodentolepsis Tapeworm Duodenum Yes Accidental ingestion of intermediate host— (=Hymenolepis spp.) beetles infected with parasite eggs (H. diminuta) or direct (=Vampirolepis spp.) ingestion of parasite eggs from infected humans (H. nana) Raillietina garrisoni Tapeworm Small intestines Yes Accidental ingestion of intermediate host—beetles infected with parasite eggs Angiostrongylus Rat lungworm Lungs, pulmonary Yes Ingestion of improperly cooked land snail/ cantonensis (nematode) arteries golden apple snail (Pomacea canaliculata) carrying the larvae of the parasite Nippostrongylus Roundworm Small intestines No – muris Euparyphium spp. Fluke Small intestines Yes Ingestion of infected land snails containing cercariae Liponyssus bacoti Tropical mite Skin Yes Ingestion can transmit Pasteurella tularensis (=Ornithonyssus bacoti) Polyplax spp. Rat louse Skin No – Hoplopleura spp. Rat louse Skin No – Table 2. Monthly prevalence (%) of infected R. tanezumi, by endo- and ectoparasitic preference, PhilRice, Nueva Ecija, Philippines, June- December 2005. Endoparasitesa Ectoparasites Sex Month Nematoda Cestoda Trematoda Tropical Rat mite louse Ab B C D E F Male June (24)c 0 91.7 8.3 4.2 8.3 29.2 100 – July (45) 0 100 8.9 0 2.2 68.9 100 – August (7) 14.3 100 28.6 14.3 14.3 57.1 100 – September (7) 0 100 28.6 14.3 28.6 71.4 100 – October (6) 0 100 0 0 0 33.3 100 – November (11)[3]d 0 100 9.1 0 0 54.6 100 0 December (8)[4] 0 100 0 0 0 87.5 100 25.0 Female June (23) 0 100 4.3 0 26.1 60.9 100 – July (43) 0 97.7 16.3 2.3 7.0 67.4 100 – August (9) 22.2 100 11.1 0 11.1 44.4 100 – September (11) 27.3 90.9 18.2 9.1 45.5 81.8 100 – October (14) 7.1 92.9 14.3 14.3 21.4 71.4 100 – November (9)[3] 22.2 100 0 0 0 88.9 100 33.3 December (8)[4] 0 100 0 0 0 100 100 0 Juvenile November [6] – - – – – – 100 83.3 with hair December [5] – - – – – – 100 40.0 aA = Angiostrongylus cantonensis, B = Nippostrongylus muris, C = Hymenolepis spp., D = Raillietina garrisoni, E = Taenia taeniaeformis, F = Euparyphium spp. bThe sex bias of infection of A. cantonensis was for female rats. cTotal number of rats examined. dTotal number of rats examined for two species of ectoparasitic rat louse. IRRN 31.1 27 Soil, nutrient, & water management Effects of cultivating a rice crop under aerobic conditions with fi lm mulching on soil microbial activity Cai Kunzheng and Luo Shiming, College of Agriculture, and Fang Xiang, College of Food Science, South China Agricultural University, Guangzhou 510642, People’s Republic of China Cultivated rice is a heavy consum- production. All 32-m2 plots were similar to that of bacteria. er of fresh water. Approximately enclosed by dams 50 cm wide and The effects of fi lm mulching 50% of the fresh water used in 15 cm high to ensure independent on soil sucrase, urease, and cata- Asian agriculture goes to rice hydrological conditions. Except lase activity are shown in Table production. Traditional lowland for traditional rice production, 1. Film mulching (T2) increased rice with continuous fl ooding has for the T2 and T3 treatments, soil catalase activity by 33.8% relatively high water inputs and the fi eld was not irrigated only over that of the check at ripening its sustainability is now being at transplanting time (1 wk after stage. There was no signifi cant threatened with increasing wa- transplanting); the remaining difference at tillering and heading ter shortage. Water savings and growth stages completely de- stages. Sucrase activity refl ects “producing more rice with less pended on rainfall. carbon transformation and soil water” are crucial to food security For all treatments, N fertil- respiration. Compared with the in China. Plastic fi lm mulching izer (180 kg N ha–1 as urea) was control, fi lm mulching increased cultivation of dryland rice has split into three doses: 40% as soil sucrase activity by 42.82%, been reported to use only 40% basal fertilizer, 30% topdressed 28.8%, and 69.9% at tillering, of the amount of water usually at the beginning of tillering, and heading, and ripening stages, needed to grow rice in submerged 30% at booting. P and K were respectively. There was no differ- conditions. Grain yields remained given at 75 kg P ha–1 and 150 kg ence in soil urease activity among at 90% of those of high-yielding K ha–1 at the start of the experi- the different treatments at tiller- submerged systems (Peng et ment. Thirty-day-old seedlings ing. But, at heading, T2 and T3 al 1999). A recent study of fi lm were transplanted at 20 × 33.3-cm had increased soil urease activity mulching on upland cultivated spacing at two seedlings hill–1. by 57.58% and 63.64% over that of rice focused on the changes in Soil samples were collected at T1. Compared with the control, no plant morphology and yield, cul- different times to measure soil mi- mulching (T1) and fi lm mulching tivation techniques, water-saving crobial amount and activity. The (T2) under aerobic conditions also effects, and nutrient use (Liang et amount of soil bacteria, fungi, and increased soil urease activity by al 1999, Cheng et al 2003). The aim actinomycetes and the activity 16.16% and 6.06%, respectively, of this study was to examine the of soil enzymes such as catalase, at the ripening stage. effects of fi lm mulching on soil sucrase, and urease were deter- In conclusion, fi lm mulching microbial amount and enzyme mined using standard protocols under aerobic conditions could activities. (Xu and Zhang 1986). increase the amount of soil bac- Rice cultivar Yue-Xiang-Zhan Compared with T3, film teria, fungi, and actinomycetes was used in the experiment mulching (T2) and no mulching and the activity of soil enzymes conducted in the early and late (T1) under aerobic conditions catalase, sucrase, and urease, season of 2002. It was laid out increased the amount of soil especially at the ripening stage. using a random complete block bacteria by 71.48% and 98.47% This would enhance nutrient design with three replications in at tillering (Table 1). It was two uptake of the root system. But, a Guangzhou. Three treatments or three times more at ripening reduction in soil nutrient content were used: T1 = rice cultivated stage, but the effect was adverse at the late growth stage, the result under aerobic conditions; T2 = during heading. Soil fungi at til- of an increase in nutrient uptake, rice cultivated under aerobic con- lering and ripening stages and is a problem to be considered (Liu ditions, covered by plastic fi lm; soil actinomycetes at heading et al 2003, Cheng et al 2003, Ai et and T3 (check) = traditional rice and ripening showed trends al 2004). 28 June 2006 Effects of fi lm mulching on the amount of soil microorganisms and soil enzyme activity.a Treatmenta Bacteria Fungi Actinomycetes Catalase Sucrase Urease (no. x 106) (no. x 104) (no. x 104) (x 10–2 mL g–1) (mg g–1) (mg g–1) Tillering T1 5.22±1.09 a 2.55±0.07 a 1.50±0.27 b 5.35±0.45 a 7.55±1.57 a 1.03±0.07 a T2 4.51±1.10 a 1.25±0.07 b 2.00±0.20 a 4.50±0.28 b 5.97±1.74 ab 0.95±0.15 a T3 2.63±0.29 b 1.23±0.51 b 1.97±0.57 a 4.70±0.30 b 4.18±0.21 b 1.09±0.18 a Heading T1 2.78±0.65 c 2.37±0.45 b 3.27±0.40 a 4.17±0.75 a 7.99±1.32 a 0.66±0.11 b T2 4.91±0.47 b 2.30±0.61 b 3.78±1.72 a 3.95±0.85 a 6.53±0.44 ab 1.04±0.17 a T3 6.85±0.26 a 3.10±0.26 a 1.70±0.28 b 2.30±0.87 a 5.07±0.90 b 1.08±0.11 a Ripening T1 11.8±1.67 a 6.81±0.54 a 4.44±0.47 a 5.48±0.84 ab 6.85±0.14 a 1.15±0.11 a T2 12.5±1.98 a 5.18±1.21 a 4.70±0.82 a 6.25±0.48 a 6.90±0.41 a 1.05±0.27 a T3 4.5±0.95 b 1.27±0.35 b 1.63±0.57 b 4.67±0.21 b 4.21±0.32 b 0.99±0.22 b aIn a column, means followed by the same letter are not signifi cantly different at the 5% level by DMRT. bT1 = rice cultivated under aerobic conditions. T2 = rice cultivated under aerobic conditions, covered by plastic fi lm. T3 = traditional paddy production (check). References irrigation water use effi ciency Xu GH, Zheng HY, editors.1986. Ai YW, Liu XJ, Zhang FS. 2004. of rice in plastic fi lm mulched Manual of soil microorganism Utilization rate of nitrogen dryland. Sci. Agric. Sin. 32(1): analysis methods. Beijing: fertilizer of rice (Oryza sativa L.) as 26-32. Agricultural Press. infl uenced by mulch and dryland Liu XJ, Wang JC, Lu SH. 2003. Effects of farming. Acta Pedol. Sin. 41(1):152- non-fl ooding mulching cultivation Acknowledgment 155. on crop yield, nutrient uptake This work was supported by the Cheng WD, Zhang GP, Yao HG. and nutrient balance in rice-wheat National Natural Science Foundation 2003. Nutrient accumulation and cropping systems. Field Crops Res. of China (30100107), the Guangdong utilization in rice under fi lm- 83:297-311. Provincial Natural Science Foundation mulched and fl ooded cultivation. Peng, S, Shen K, Wang X. 1999. A new of China (20000636), and the Education J. Plant Nutr. 26(12):2489-2501. rice cultivation technology: plastic Ministry Doctoral Fund of China Liang YC, Hu F, Yang MC. 1999. fi lm mulching. Int. Rice Res. Notes (2000065402). Mechanisms of high yield and 24(1):9-10. The nature of humic substances under long-term manuring and fertilization in a rice-wheat system D.K. Das and Nand Ram, Department of Soil Science, G.B. Pant University of Agriculture and Technology, Pantnagar 263145, India E-mail: nandram@fastmail.fm, drdkdas@rediffmail.com Humic substances (HS) are the insoluble in both alkali and acid. The details of the selected most abundant organic constitu- Information on the nature of HS long-term nutrient input treat- ents present in soil and aquatic synthesized in a fi xed cropping ments quadruplicated in a ran- environments. These substances sequence is lacking. This study domized block design in the result from a humifi cation pro- was conducted during the 28th permanent fi eld experiment are cess that involves microbial and year of a long-term fertilizer ex- shown in Table 1. These nutrient chemical transformation of organ- periment established in 1971 with inputs were regularly applied ic debris. On the basis of varying a rice-wheat-cowpea sequence on only to rice and wheat, while cow- solubility in acid and alkali me- virgin land classifi ed as Mollisol pea has been grown as a fodder dia, the HS are divided into three at Pantnagar (29º N, 79º 3’ E) in crop without any nutrient input. fractions: (i) humic acid (HA)—al- northern India. The initial soil In rice-wheat, annual rates of op- kali soluble but acid insoluble, (ii) characteristics were pH 7.3, EC of timal N, P, and K addition were fulvic acid (FA)—soluble in both –0.35 dS m–1, and –1.48% organic 240, 52, and 70 kg ha–1, respec- alkali and acid, and (iii) humin— C (Nand Ram 1995). tively. In NPK + FYM, farmyard IRRN 31.1 29 Table 1. Quantity of organic carbon, total N, and humic substances in soil under different Table 2. Elemental ratios and E4/E6 of HA long-term treatments. and FA under different long-term treat- ments. Humic Treatment Details of treatment Soil pH Organic C Soil N substances Treatment Elemental ratio E4/E6 (%) (%) (g kg–1 soil) C/H C/N O/H HA FA Humic acid Fallow No crop, no use of fertilizers 7.6 1.36 0.126 3.4 11.8 Fallow 10.42 13.02 7.78 8.34 or manure Control 12.75 14.57 10.37 7.74 Control Cropping without fertilizers 7.7 0.47 0.107 1.8 3.7 NPK 11.41 11.93 8.36 8.20 or manure NPK+FYM 10.29 11.82 6.35 8.55 NPK Cropping with optimal NPK fertilizers 7.7 0.81 0.145 2.5 7.7 CD (5%) 0.744 2.203 0.697 0.148 NPK+FYM Cropping with optimal NPK and FYM 7.6 1.54 0.157 3.5 17.6 Fulvic acid CD (5%) NSa 0.04 0.008 0.010 0.057 Fallow 9.20 12.92 11.31 10.57 Control 10.26 13.92 14.32 9.51 aNS = nonsignifi cant. NPK 9.64 11.12 10.71 10.21 NPK+FYM 8.88 10.32 9.26 10.90 CD (5%) 0.940 1.414 0.286 0.283 manure (FYM) was incorporated Vendette 1975). at 15 t ha–1 y–1 before wheat sow- The quantity of HA and FA ing, along with optimal NPK. isolated from the different treat- As compared with fallow, the Composite surface soil samples ments ranged from 1.8 to 3.5 and elemental ratios of the HS were were collected at 0–15-cm depth 3.7 to 17.6 g kg–1 soil, respec- larger in the control but smaller to diagnose the nature of HA and tively (Table 1). In general, the under the NPK+FYM treatment. FA synthesized under the differ- FA fraction dominated about 2–5 The HS synthesized under the ent long-term treatments. times over HA, possibly due to control appears to be highly Humic substances were ex- biochemical transformations of mature due to the dominance tracted after initial decalcifi cation open-chain compounds of plant of hydrophobic properties with of soil samples by repeated treat- residues into soil humus. Com- low mobility. With continuous ment with 0.1 N NaOH. These pared with fallow, the amounts manuring and fertilizers in rice were then fractionated into HA of HA and FA in the control and wheat, the HS seemed to be and FA by acidifying the alka- were reduced to about half and younger and more labile, having line extract. HA was purifi ed by one-third, respectively, owing to hydrophilic properties under redissoving in 0.1 N NaOH, fol- the decay of organic matter by in- NPK+FYM (Olk et al 2000). lowed by centrifuging, treatment tensive cultivation (Skjemstad et Absorbance of HS measured with HF + HCl, dialyzing against al 1986). Even the use of optimal at 465 (E4) and 665 nm (E6) varied distilled water, and fi nally dry- NPK fertilizers could not prevent from 0.719 to 0.968 and 0.084 to ing. FA was purifi ed by adsorbing the decline in HS. However, in- 0.125 for HA; and from 0.109 to on activated charcoal, washing tegrated nutrient management 0.352 and 0.010 to 0.037 for FA, with 1 N H2SO4 until free of Fe2+, (NPK+FYM) not only restored the respectively, revealing that HA eluting with 1 N NH4OH, and status of HA but also enhanced absorbed more light than FA ow- fi nally drying (Nand Ram and that of FA considerably (Sen et ing to the large proportion of C in Raman 1984). al 1994). the nuclear matrix of the former. The nature of HA and FA The elemental ratios of C/H, The higher absorbance at shorter synthesized under different long- C/N, and O/H (Table 2) ranged wavelength is attributed to ac- term treatments was evaluated from 10.29 to 12.75, 11.82 to 14.57, celerated mobility of electrons in terms of elemental ratios and and 6.35 to 10.37 in HA; and from over unsaturated structures con- E4–E6 ratio. In both HA and FA, 8.88 to 10.26, 10.32 to 13.92, and jugated with HS nuclei. the percentage of C, H, and N 9.26 to 14.32 in FA, respectively. The E4/E6 is independent was determined using a CHN The HA showed comparatively of the concentration of HS but analyzer and O was computed wider C/H and C/N but nar- varies with source of origin. It by difference. E4/E6 was esti- rower O/H than FA isolated ranged from 7.74 to 8.85 and mated by dissolving 2.5 mg HA from the same treatment. This 9.51 to 10.90 for HA and FA, re- or 5 mg FA in 10 mL 0.5 N NaOH may be attributed to the stronger spectively (Table 2), indicating a and measuring the absorbance aromatization of HA in compari- more humifi ed HA. As compared of HS at 465 (E4) and 665 nm son with FA (Rautela and Nand with fallow, the lower magnitude wavelengths (E6) (Schnitzer and Ram 2000). of E4/E6 in the control indicated 30 June 2006 more maturity of HS. Long-term the level of HA but also enhanced organic matter with intensifi ed manuring and fertilizer use in that of FA, being less humifi ed lowland rice cropping. Soil Sci. rice and wheat resulted in higher and having poorer aromatization Soc. Am. J. 64:1337-1347. Rautela LMS, Nand Ram. 2000. E4/E6 under NPK+FYM, inferring than those under fallow. Characterization of humic and the presence of large proportions fulvic acids isolated from of aliphatic structures during the References organic farm wastes. Acta Agron. synthesis of HS. Consequently, Chen Y, Senesi N, Schnitzer M. 1977. Ovar. 42:95-100. HA and FA were least humifi ed Information provided on humic Schnitzer M, Vendette E. 1975. (Chen et al 1977). These results substances by E4/E6 ratios. Soil Chemistry of humic substances Sci. Soc. Am. J. 41:352. extracted from an Arctic soil. Can. showed great resemblance with Nand Ram. 1995. Long-term effects J. Soil Sci. 55:93-104. C/H and C/N, whose lower of fertilizers on crop production Sen D, Chen EF, Xu XC, Zhang JH, Li magnitude refl ected weak aro- and soil properties in a Mollisol. HZ. 1994. Effect of organic manure matization of HS. Technical Research Bulletin 124. application on physical properties Continuous cropping of rice- Directorate of Experiment Station, and humus characteristics of G.B. Pant University of Agriculture paddy soil. Pedosphere 4(2):127- wheat without any nutrient input and Technology, Pantnagar, India. 135. (control) results in decreased syn- Nand Ram, Raman KV. 1984. Stability Skjemstad JO, Dalal RC, Barron PF. thesis of HS, which could not be constants of complexes of metals 1986. Spectroscopic investigations restored even by long-term use of with humic and fulvic acids of cultivation effects on organic optimal NPK fertilizers. The joint under non-acid conditions. Z. matter of Vertisols. Soil Sci. Soc. use of optimal NPK fertilizers Pfl anzenern. Bodenk. 147:171-176. Am. J. 50:354-359. Olk DC, Brunetti G, Senesi N. 2000. and FYM not only maintained Decrease in humifi cation of IRRN 31.1 31 Socioeconomics Impact analysis of Technology Assessment and Refi nement through Institution-Village Linkage Program K.D. Kokate and L.G. Pawar, AICRP on Weed Control, B.S. Konkan Krishi Vidyapeeth, Dapoli 415712, Ratnagiri District, Maharashtra, India The Indian Council of Agricul- rabi rice, which totally disap- Rice and fingermillet have tural Research has developed peared, and local rice varieties traditionally been the favorite a new approach, the Technol- (kharif), under which 60.72% of food crops among the local peo- ogy Assessment and Refi nement the area was reduced with the ple. More of the newly introduced through Institution-Village Link- simultaneous increase in area HYVs (R-24, Palghar 1, Sahyadri, age Program (TAR-IVLP), that (201.24%) under HYVs in the R-3) were grown because of their emphasizes the participatory same season. The area devoted to higher productivity in response to approach in technology selection, rabi rice was used to grow other balanced fertilizer use, suitability testing, evaluation, refi nement, seasonal, more remunerative in different topographical situ- and adoption. The TAR-IVLP has crops with less water require- ations, and grain type and taste been implemented in the village ments—e.g., rabi groundnut, veg- that local consumers preferred. Hodawade of Vengurle tahsil in etables, and fi ngermillet. More- Similarly, fingermillet variety Sindhudurga District, Maharash- over, the available water was HR 374 and rabi groundnut be- tra, India, since 1996, providing diverted to maintain the newly came more popular because of an ideal platform through which planted cashew nut, coconut, and their high productivity and the appropriate technology is dis- mango orchards, which exhibited introduction of HYVs Konkan seminated to stakeholders. area expansion of 39.67%, 28.63%, Gaurav and TG 26. The kharif Agricultural data (e.g., area and 28.08%, respectively. groundnut varieties introduced under different crops) before the project (1995-96, period I) and af- ter the 5-y implementation (2000- Table 1. Impact of IVLP on area under different crops and income of farm families.a 01, period II) were collected using Farmers growing this crop (no.) Area (ha) participatory rural appraisal Crop grown Period I Period II Difference Period I Period II Difference (PRA) and consultations with the (no.) (%) land revenue offi ce in the village Kharif rice 372 156 -216 89.29 35.52 –60.22 (Table 1). Local varieties (74.85) (24.68) (25.32) (7.79) HYVs 123 473 +350 59.52 During period I, the total area 170.30 201.24 (24.75) (74.85) (16.88) (39.34) planted to different crops was Rabi rice 153 – – 27.90 –b – 352.68 ha. Of this, 25.32% was (30.78) (7.91) occupied by local kharif-season Ragi (fi nger millet) 31 56 +25 4.10 8.60 +109.76 (6.24) (8.86) (1.16) (1.89) rice varieties, followed by mango Kharif groundnut 16 68 +52 2.35 5.45 +131.91 (21.60%), kharif high-yielding va- (3.22) (10.76) (0.67) (1.20) rieties (HYVs) (16.88%), coconut Rabi groundnut 185 45 –140 19.51 27.25 +39.67 (37.22) (7.12) (5.53) (5.98) (10.25%), cashew nut (9.82%), rabi Mango 305 428 +123 76.20 97.60 +28.08 hot-weather rice (7.91%), rabi hot- (61.37) (67.72) (21.60) (21.41) weather groundnut (5.53%), rabi Cashew nut 245 379 +134 34.62 48.25 +39.37 (49.30) (59.97) (9.82) fi ngermillet (1.16%), vegetables (10.59) Coconut 99 142 (0.86%), and kharif groundnut +43 36.15 46.50 +28.63 (19.92) (22.47) (10.25) (10.20) (0.67%). Vegetables 50 128 +78 3.04 7.35 +141.78 During period II, the area (10.06) (20.25) (0.86) (1.61) Total 497 632 under cultivation increased by 135 352.68 455.82 +29.24 (100.00) (100.00) (100.00) (100.00) 103.14 ha because the area under aNumbers in parentheses are percentages of total. bProduction of rabi hot-weather groundnut and vegetables decreased each crop expanded, except for in 1999-2000 (period II) as farmers failed to construct a temporary dam. 32 June 2006 were Konkan Guarav and Phule etables such as chili, particularly 58, and 45, respectively. The cor- Pragati. The package of balanced the local variety that gets a price responding increase in income fertilizer use, timely weed con- premium for its color and taste. was Rs 25,000, Rs 25,000, and Rs trol, and intercropping motivated Rice productivity increased 8,000 from period I to period II farmers to expand the area under from 2.30 t ha–1 (period I) to 4.52 (Table 3). groundnut. t ha–1 (period II), an increase of Thus, because of the IVLP Mango (variety Alphonso) 96.5% (Table 2). This increase activities in Hodawade, there and coconut (variety West Coast with respect to the important was a signifi cant increase in the tall) have traditionally been area under dif- grown. Verifi cation trials and on- Table 2. Increase in productivity of different crops fi ve years after ferent crops, farm trials on the use of growth inception of IVLP implementation. indicating an inducers and insecticides encour- Crop Period I Period II Districta average increased level aged farmers to cultivate mango. Rice (t ha–1) 2.30 4.52 1.91 of adoption. The use of manure and balanced Mango (t ha–1) 1.59 4.05 2.00 Similarly, crop Cashew (t ha–1) 0.82 0.99 0.91 fertilization for both mango and Coconut (nuts palm–1) 45,600 96,280 47,000 p r o d u c t i v - coconut increased yield and en- Vegetable—lady fi nger (t ha–1) 6.00 7.30 – ity improved, abled many farmers to grow these aNon-IVLP area. leading to fa- in additional areas. vorable chang- The area under cashew nut crops such as mango, cashew nut, es in the socioeconomic status of increased because of the introduc- coconut, and lady’s fi nger was the villagers. This is gleaned from tion of varieties such as Vengurle 155%, 20.5%, 11%, and 21.67%, the change in asset position of the 4 and Vengurle 7, which have respectively. Compared with farmers and the increase in their bold nut size. The high yield po- the whole Sindhudurga District, annual income. tential of these varieties was ob- which is a non-IVLP area, the served in the large-scale coppice increase in productivity of rice, grafting program established for mango, cashew nut, and coco- Table 3. Change in number of farm families and their annual income. local cashew trees. As in IVLP ac- nut in Hodawade was 136.6%, tivities, the increase in area under 102.5%, 8.8%, and 104.85%, re- Period I Period II Difference (no.) horticultural crops was brought spectively, signifying the impact Group Number of farm families about by giving farmers access of TAR-IVLP. Also, between the Annual income (Rs) to facilities under an employment two periods, the number of pump guarantee scheme. sets in the village increased by Higher income 12 44 +32 125,000 150,000 +25,000 Noteworthy is the number 20.83%, drinking water wells by Medium income 180 238 +58 of farmers taking agriculture as 54%, cows by 417%, buffaloes 30,000 55,000 +25,000 a profession—it increased from by 816%, and poultry by 141%. Lower income 305 350 +45 10,000 18,000 +8,000 497 to 632. Many of them showed The increase in number of farm Landless 34 34 0 interest in cultivating HYVs of families in the higher, medium, 6,000 9,000 +3,000 rice, mango, cashew nut, and veg- and lower income group was 32, A preliminary forecast of the intensifi cation of global and regional rice production Wenjun Zhang and Yanhong Qi, Research Institute of Entomology, Zhongshan University, Guangzhou 510275, People’s Republic of China E-mail: zhangwenjun@scientist.com Rice is the staple food that feeds reduced the food shortage in Asia and human health (Altieri 1994, nearly half of the world popula- and the world (IRRI 2003). How- Heong and Escalada 1998, Til- tion (Way and Heong 1994). In ever, the increased use of land and man et al 2001). A perspective on the past 3 decades, the steadily pesticides aggravates the deterio- future rice production is essential increasing rice production has ration of environmental quality for estimating the biological and IRRN 31.1 33 environmental impacts caused by (1980-96), rice fungicide sales ing involved estimates of rice intensive rice production and for (1980-96), rice herbicide sales production trajectories of the taking appropriate measures to (1980-96), and rice pesticide sales past 3 decades. These trajectories avoid these side effects without (1980-96)—were included for included impacts of past techno- threatening overall food security. the world, Asia, South America, logical developments, changes In this paper, seven variables re- North and Central America, Af- in consumer choices, and policy lated to intensive rice production rica, Europe, and Oceania (IRRI factors. Like other agricultural were fi tted with data in the past 2003). Missing data were reason- forecasts, ours assume similar 3 decades and a forecast for the ably interpolated or extrapolated technological, environmental, years 2005-25 was made. by linear interpolation and linear and behavioral changes in the The historical data for this trend at point (SPSS for Windows future (Tilman et al 2001). forecasting exercise were down- 11.0.0, 2001). The temporal trend Each variable, except for loaded from World rice statistics of each variable was a linear rough rice area of South America, (www.irri.org/science/rices- function of time. We thus use was a linear and strong func- tat/index.asp). Seven variables univariate linear regression (SPSS tion of time (see table). With an representing rice production, for Windows 11.0.0, 2001) to fi t estimated growth rate of 748,240 and biological and environmen- and forecast global and regional ha y–1, the global rough rice area tal impacts—e.g., rough rice area trends for each of the variables would have an increase of 17.47% (1961-2002), rough rice produc- (see table). The adjusted R2 of the by 2025 compared with 2002. Asia tion (1961-2002), rough rice yield regression was tested with levels ranks fi rst in the growth rate of (1961-2002), rice insecticide sales of signifi cance P. The forecast- land use (589,630 ha y–1) and to- Univariate linear regressions and forecasts for years 2005 and 2025, based on trends observed in the past 3 decades and their time dependence. World Asia South North & Central Africa Europe Oceania America America Annual growth rate 748.24 589.63 17.71 15.68 119.8 7.22 3.36 Adjusted R2 0.853** 0.857** 0.020 0.527** 0.964** 0.685** 0.853** Forecasts of 2005 157,883 140,312 6,417 2,081 8,064 606 178 rough rice 2010 161,624 143,260 6,505 2,159 8,663 642 195 area 2015 165,366 146,208 6,594 2,237 9,262 678 211 (000 ha) 2020 169,107 149,157 6,682 2,316 9,861 714 228 2025 172,848 152,105 6,771 2,394 10,459 750 245 Annual growth rate 9790.95 8926.58 314.59 188.24 307.31 44.96 31.07 Adjusted R2 0.989** 0.987** 0.910** 0.902** 0.915** 0.824** 0.908** Forecasts of 2005 649,279 593,278 21,001 12,332 17,419 3,215 1,401 rough rice 2010 698,234 637,911 22,574 13,273 18,956 3,440 1,557 production 2015 747,189 682,544 24,147 14,214 20,492 3,664 1,712 (000 t) 2020 796,144 727,177 25,719 15,155 22,029 3,889 1,868 2025 845,099 771,809 27,293 16,097 23,566 4,115 2,023 Annual growth rate 0.055 0.057 0.051 0.072 0.014 0.022 0.091 Adjusted R2 0.984** 0.983** 0.805** 0.964** 0.662** 0.310** 0.690** Forecasts of 2005 4.22 4.26 3.58 6.21 2.26 5.49 8.52 rough rice 2010 4.49 4.55 3.84 6.57 2.33 5.59 8.97 yield 2015 4.77 4.83 4.09 6.93 2.4 5.7 9.43 (t ha–1) 2020 5.04 5.12 4.35 7.28 2.47 5.81 9.88 2025 5.32 5.41 4.59 7.64 2.54 5.92 10.34 Insecticide Fungicide Herbicide Pesticide Annual growth rate 47.29 41.43 59.57 163.52 Adjusted R2 0.801** 0.944** 0.949** 0.949** Forecasts of 2005 1,818 1,346 1,895 5,306 rough rice 2010 2,054 1,553 2,193 6,124 pesticide 2015 2,291 1,761 2,491 6,942 sales ($ million) 2020 2,527 1,968 2,789 7,759 2025 2,764 2,175 3,086 8,577 aLevels of signifi cance: ** = P < 0.0001; * = P < 0.01. 34 June 2006 tal area, whereas South America million y–1) is the fastest com- patterns could change and future and Africa rank second and third, pared with sales of insecticide intensifi cation of rice production respectively (see table). Of the six ($47.29 million y–1) and fungicide could deviate from what is pre- regions, Oceania has the smallest ($41.43 million). By 2025, global dicted. Further forecasts may be growth rate of land use and total rice pesticide sales would reach conducted with more dependent area. If past patterns continue, $8,577 million. and independent variables taken global rough rice production If past patterns continue, area, into consideration. would increase with an annual production, yield, and pesticides rate of 9,790,950 t, largely driven of rough rice for the world, Asia, Acknowledgment by Asia’s growth rate (8,926,580 America, Europe, Africa, and This research was partially supported t y–1) and prevailing production. Oceania would increase at con- by the National Natural Science South America and Africa would stant annual growth rates. Asia is Foundation of China, through Grant No. 30170184, and the Foundation share similar annual growth the rice production center in the of Scientifi c Research for Personnel rates and production expecta- world and this continent would from Abroad through the Ministry of tions in rough rice production determine the future trend of Education of China 2000. (see table), while Oceania would global rice production. South hold the least annual growth America and Africa would remain References rate and proportion of rough rice second and third in p roduction, Altieri MA. 1994. Biodiversity and pest production. With values of 9.88 t yield, and annual growth rate of management in agroecosystems. ha–1 and 0.091 t ha–1 y–1 New York: Haworth Press. 185 p. , Oceania rough rice. Oceania would contin- Heong KL, Escalada M. 1998. Pest has the largest yield expectation ue to hold the highest yield in the management of rice farmers and annual growth rate in the next 20 years. The global need for in Asia. Manila (Philippines): six regions, followed by North rice herbicide was larger than that International Rice Research and Central America. With its for insecticide and fungicide and Institute. 245 p. predominant proportion in rice this trend would remain in the IRRI (International Rice Research Institute). 2003. World rice statistics. production, Asia would yield future. Habitat destruction and Manila (Philippines): IRRI. a similar production forecast pesticide use in rice production Tilman D, Fargione J, Wolff B. 2001. in 2025 (5.41 t ha–1) and annual cause environmental degradation Forecasting agriculturally driven growth rate (0.057 t ha–1 y–1) with or affect human health (Altieri global environmental change. the world (5.32 t ha–1 and 0.055 1994, Heong and Escalada 1998, Science: 292:281-284. Way MJ, Heong KL. 1994. The role of t ha–1 y–1, respectively). Global Tilman et al 2001). Advances in biodiversity in the dynamics and annual pesticide sales would rice science and technology and management of insect pests of continually increase at the annual sound policy decisions are need- tropical irrigated rice—a review. growth rate of $163.52 million ed to avoid these outcomes. Bull. Entomol. Res. 84:567-587. (see table). The global increase With advances in technology in annual herbicide sales ($59.57 and in societies, however, these Farmer participatory learning on integrated crop management of lowland rice in Mali F.E. Nwilene, Africa Rice Center (WARDA), PMB 5320, Ibadan, Nigeria; M.A. Togola and O. Youm, Africa Rice Center (WARDA), 01 BP 2031, Cotonou, Benin Republic; A. Hamadoun, Institute of Rural Economy/Centre Regional de Recherche Agronomique, Sikasso, Mali E-mail: f.nwilene@cgiar.org The African rice gall midge and irrigated lowland rice, posing integrated pest management (AfRGM) Orseolia oryzivora Har- the most serious challenge to hu- (IPM) components. But, there ris and Gagné and rice yellow man endeavors in West Africa has been no focus on farmers’ mottle virus (RYMV) are princi- (Nwilene et al 2002). Consider- needs, knowledge, and capacity pal biotic constraints to the sus- able progress has been made to for learning ways of managing tainable intensifi cation of rainfed control both stresses through pest and disease problems under IRRN 31.1 35 locally observed conditions (De- information on production con- A striking observation at Sikasso foer et al 2004). Often, farmers straints and farmers’ perceptions, was the greater participation of are handicapped because they local knowledge, and practices. national agricultural research and lack a basic understanding of pest Before the training exercise, all extension systems and extension and disease symptoms, ecology, constraints listed by the farmers agents; they were seen interacting natural enemies, development were summarized and elucidated more frequently with farmers. patterns of crops and pests, ap- on, giving technical explanations In Niono, the scenario was propriate control measures, soil and practical advice for a better different. Many farmers already condition and its effect on the understanding of each problem. had regular contact with exten- crop, and the effect of weather Some key indicators to assess sion agents before and after the conditions on pest populations farmers’ performance were used training. They knew improved and disease incidence. They do before and after the training as rice varieties and had applied not understand pest resurgence well as to compare trained (par- improved techniques and mineral and the reasons for not using ticipating) with untrained (non- fertilizers even before the train- insecticides indiscriminately. participating) farmers. ing. The training only added to There is a growing realization The following constraints what they knew. However, the that future agricultural growth were identifi ed in Sikasso: low training afforded them the op- hinges on smallholder farmers, soil fertility, high price of min- portunity to appreciate the value who must be knowledgeable and eral fertilizers, iron toxicity, late of following a cultural calendar, exposed to a learning process that weeding, low rice yields, non- using chemical pesticides judi- involves continuous observa- compliance with cultural calen- ciously, rotating nursery places, tion and feedback from the local dar, pest problems (stem borers, using organic fertilizers in addi- environment and that enhances AfRGM, termites), disease prob- tion to mineral ones, and using decision-making capacity. This lems (RYMV, neck blast), un- plant-based pesticides. paper reports efforts made to availability of good seed, lack of For the fi rst time in both lo- train lowland rice farmers on seed conservation methods, and cations, farmers started putting crop management practices and lack of local names for improved down observations in their own IPM options to enable them to varieties, leading to confusion in fi eld books (Fig. 1). carry out their own experiments their use and dissemination. The crop yields of the trained on their own farms. In Niono, the constraints farmers were higher than those of Studies were carried out in identifi ed were low soil fertility, the untrained ones (Fig. 2). Rice two rice-cropping systems of high price of mineral fertilizers, yield increased by 2.0 t ha–1 (36% Mali—the rainfed lowland rice users’ inadequate knowledge increase) in the irrigated system system in Sikasso and the irri- of chemical pesticide effects, no and by 1.3 t ha–1 in the rainfed gated rice system in Niono. Fifty proper seed conservation method, lowland (93% increase). In the farmers (31 men and 19 women) problems on water management, latter system, pest and disease participated in the learning and lack of agricultural equipment, problems decreased from 80% training activities (30 farmers not following the cultural calen- and 75%, respectively, before from three villages in Sikasso dar, iron toxicity, and problems of the training, to 16.6% and 36.6% and 20 farmers from two villages pests (caseworms, AfRGM, stem after the training. In the irrigated in Niono). A number of criteria borers) and diseases (RYMV). system, these problems decreased were used to select the farmer Before the training, a majority from 60% and 80% before the participants: residence in one of of the farmers in Sikasso did not training to 10% and 20% after. the selected villages, experience follow the cultural calendar (syn- In conclusion, these studies in rice cultivation, gender (num- chronous planting, crop rotation) showed that farmers’ pest man- ber of active males and females), and did not know any improved agement practices in Sikasso and availability to participate in train- rice varieties and techniques Niono had undergone signifi cant ing sessions, and possession of an (plowing, seedbed preparation, changes. Farmers have become so easily accessible fi eld. A training planting). After the training, a knowledgeable that they can now manual, prepared in the local great number of farmers began challenge agrochemical salesmen language (Bambara), was given using improved varieties, plant- to prove the harmlessness of their to participating farmers. A ques- based pesticides, mineral fertil- products to target and nontarget tionnaire was developed to elicit izers, and improved techniques. organisms. It was suggested that 36 June 2006                                  ! "  !         .             #    # $ %$ &$ '$ ($ )$$ )%$ $ %$ &$ '$ ($ )$$ )%$ *    +,- Fig. 1. Indicators to assess farmers’ knowledge before and after training, Sikasso and Niono, Mali, 2004 wet season. 2   + 3)- this training has the potential to midge in West Africa. Int. J. Pest ( complement the extension deliv- Manage. 48(3):195-201. / *     Defoer T, Wopereis MCS, Idinoba P, '       ery systems in Mali and therefore Kadisha TKL, Diack S, Gaye M. 0 should be scaled up to cover 2004. Curriculum for participatory & larger groups of farmers. learning and action research 1 (PLAR) for integrated rice % management in inland valleys of ) References $ Nwilene FE, Williams CT, Ukwungwu Sub-Saharan Africa: facilitators’     MN, Dakouo D, Nacro S, manual. ADRAO, Bouaké, Côte 4    Hamadoun A, Kamara SI, d’Ivoire and IFDC, Muscle Shoals, USA. Fig. 2. Mean yields of participating and Okhidievbie O, Abamu FJ, Adam nonparticipating farmers, Sikasso and Niono, A. 2002. Reactions of differential Mali, 2004 wet season. rice genotypes to African rice gall TAR-IVLP: an effective institutional mechanism for assessing the appropriateness of rice varieties P. George Joseph, K.P. Santhosh Kumar, M. Anantharaman, and S. Ramanathan, Central Tuber Crops Research Institute (CTCRI), Thiruvananthapuram, Kerala, India Rice is cultivated under different conditions. Farmers’ participation nology Assessment and Refi ne- types of production systems by in technology assessment is es- ment through Institution-Village farmers living in varied socio- sential in generating technologies Linkage Program (TAR-IVLP), economic and agroecological suitable to their needs. The Tech- promoted by the Indian Council IRRN 31.1 37 of Agricultural Research (ICAR), The farmers rejected the 4  +)0,-  +0%,- adopts a holistic approach with short- and long-duration variet- the village as an operational unit. ies, owing to the low straw yield  +&,- The use of farmers’ participatory of the former and the susceptibil-  research was the main component ity to lodging and late maturity of +&,- in the technology assessment. The the latter. The farmers preferred CTCRI under ICAR implemented the medium-duration varieties the TAR-IVLP in Chenkal village because of their high grain yield in Thiruvananthapuram District, (>4 t ha–1) and high straw yield  +%0,- Kerala State, southern India. Here, (>5 t ha–1). Of the 20 odd varieties rice is cultivated as a transplanted tested, farmers preferred Uma, Varietal coverage of rice under IVLP. crop under canal-irrigated condi- Athira, Aiswarya, and Remya. tions. Average productivity in The matrix ranking conducted this lowland production system with 50 farmers showed Uma and varieties have saturated the entire is 1.9 t ha–1; the district average Athira to be the most preferred rice-growing area in the village in is 2.2 t ha–1. Conway et al (1987) because they had high grain yield both seasons, gradually replacing revealed that not using high- (5 t ha–1), high straw yield (up to 6 the traditional varieties in the yielding varieties suited to local t ha–1), tolerance for pests and dis- neighboring villages. In helping farming conditions contributed to eases, good cooking quality, high identify appropriate rice variet- the low productivity of this rice- volume of cooked rice, threshabil- ies in the adopted village, the based production system. ity, good grain and straw quality, TAR-IVLP has established itself Initially, farmers cultivated and high marketability. There as a model technology evaluation local varieties such as Thuluna- was an increase in net returns of mechanism. dan, Kochuvithu, and Thavalak- 25–30% (see table). kannan in addition to improved The performance evaluation References variety H4 (Anantharaman et al of these high-yielding variet- Anantharaman M, Ramanathan S, 2001). These varieties were pre- ies revealed their suitability for Potty VP, Sheela MN, Suja G. ferred because of their high straw cultivation in both seasons and 2001. Institution Village Linkage Programme—agroecosystem yield and good cooking quality. qualities comparable with those analysis. Thiruvananthapuram: To identify suitable high-yielding of local types. Currently, these Central Tuber Crops Research rice varieties, farmer participato- high-yielding varieties occupy a Institute. ry on-farm trials were conducted considerable area in the village— Conway G, McCracken R, Jennifer A, during kharif (Jun-Sep) and rabi 52% under Uma, 25% under Pretty JN. 1987. Training notes for agroecosystem analysis and (Oct-Jan) seasons. Invited to par- Athira, 4% each under Aiswarya rapid rural appraisal. International ticipate were 200 farmers from and Remya, and the rest (15%) Institute for Environment and the village. The IVLP aimed to under local varieties (see fi gure). Development. compare the performance of more Through a farmer-to-farmer than 20 high-yielding rice variet- seed-exchange program, these ies—Kanchana, Matta Triveni, Bhagya, Gowri and Harsha (short duration), Sabari, Kanakom, Matrix rankinga of rice varieties based on preferred characters. ASD16, IR64, Athira, Aiswarya, Character Kochuvithu Thulunadan Uma Athira Aiswarya Remya Uma, Remya, Karishma and Grain yield (>4 t ha–1) 1 2 5 4 4 4 Bhadra (medium duration), Pon- Straw yield (>5 t ha–1) 2 3 4 5 3 3 Pest and disease tolerance 1 1 4 4 4 3 mani, Dhanya, Karuna, Sagara, Good cooking quality 3 3 4 5 4 3 Makaram and Kumbham (long Threshability 2 2 4 4 4 4 duration)—with those of local Quality of grain 2 4 4 5 4 3 Quality of straw 3 4 4 5 4 3 varieties. All agronomic practices Marketability 3 4 5 4 4 3 were followed under farmers’ Net returns 1 3 5 4 5 4 management. a1 = least/minimum, 5 = maximum/highest/most/best. 38 June 2006 NOTES FORM THE FIELD Rice yellow mottle virus the healthy and infected controls ticed in 1966 in Kenya. It is now disease, a new disease of were 0.24 and 1.96, respectively. known to occur in most countries rice in Zamfara, Nigeria The pathogen was therefore iden- of eastern, western, southern, tifi ed as RYMV. and Central Africa where rice is M.D. Alegbejo, B.A. Raji, I.U. Abubakar, The total area surveyed was grown. Very recently, the first and O.O. Banwo, Institute for Agricultural Research (IAR), Ahmadu about 80 ha. The varieties planted, report of its occurrence in Europe Bello University, PMB 1044, Zaria, under lowland conditions, were was made (Köklü and Yilmaz Nigeria ‘ex-China’ and ITA150. The fi elds 2004). Early infection of suscep- were badly affected, showing a tible varieties can cause death of scale of damage not previously plants and yield loss estimates Following a report to IAR of a seen in Nigeria. Farmers could can range from 20% to 100% in disease outbreak in Zamfara, an not harvest any rice; others had several countries. important rice-growing state in to abandon their fi elds. The same In view of the increasing inci- northwestern Nigeria, an exten- incidents were reported in some dence and importance of RYMV sive survey was carried out to wards in Tanzania (Luzi-Kihupi in African rice production, addi- assess the situation. The disease et al 2000), a country where iso- tional work is needed in Nigeria, symptoms observed were stunt- lates are highly diverse (Banwo which is one of the main rice ing, reduced tillering, mottling, et al 2004). Visual observations producers in Africa. yellowing, empty seeds, poor indicated the presence of Trichispa panicle development, distorted sericea and Conocephalus longipen- References spikelets, and sterility. On the nis, which are known vectors of Banwo OO, Winter S, Koerbler M, basis of these observations, it RYMV. Abdallah RS, Makundi RH. appeared that the plants were Recent surveys showed that 2004. Molecular variability and distribution of rice yellow mottle infected with rice yellow mottle the disease has spread to other virus isolates in Tanzania. Acta virus (RYMV). states such as Kaduna, Katsina, Virol. J. 48:69-71. Samples were collected and and Sokoto (all in northwestern Köklü G, Yilmaz O. 2004. Research on analyzed by ELISA with the Nigeria). Even within these states, rice ragged stunt and rice yellow antibody for the virus. The ab- the disease has become increas- mottle viruses on rice grown in Edirne, Turkey. Cereal Res. sorbance values for virus-free ingly important. Rice yellow Commun. 32(3):387-395. samples were, in most cases, mottle disease was not known to Luzi-Kihupi A, Mlozi MRS, Mabagala similar to those of the extraction occur in this part of the country. RB, Mushobozy DMK, Msolla- buffer control, indicating a clear Insect pests and iron toxicity are Nchimbi S. 2000. Occurrence background. The average ELISA the major biophysical constraints of rice yellow mottle virus in readings (absorbance value) from observed in other parts of the Tanzania. Tanzania J. Agric. 3(2):87-96. the diseased samples were within country. the 1.89–1.95 range, while those of RYMV disease was fi rst no- International Rice Research Notes 1 9 7 6 - 2 0 0 6 IRRN 31.1 39 Designation of R.S. Zeigler D.J. Mackill G.L.S. Capilit IRRI breeding lines IRRI has decided to change the system for designation of its elite lines and fi xed breeding lines. The new policies were outlined in a DG memo on 26 J anuary 2006. The following are new policies regarding the designation of IRRI g ermplasm. Designation of IRRI crosses 1. All IRRI-developed breeding materials should have an “IR” designation used as an offi cial name. This applies to improved breeding lines, genetic stocks, mapping populations, and transgenic materials. All these materials should be entered into the IRIS database and have a GID number assigned. 2. All crosses made at IRRI should have an “IR” cross number designation as- signed by the database administrator of PBGB. The hybridization unit of PBGB can assist any researcher with making crosses and numbering them. 3. Segregating generations resulting from IRRI crosses should be numbered by generation using the SetGen module of IRIS. Plant numbers are followed by a dash with the fi rst number being the F2 plant (F3 row) (e.g., IR88888-21-2-2-2 is an F6 line harvested from an F5 plant). If a segregating line is planted in a place other than IRRI (e.g. Shuttle Breeding Program, nurseries in other sites), the resulting derivative should have a 3-letter code for the site and a space before the plant number (e.g IR88888-21-2-UBN 2-2) to indicate that the F5 generation was grown in Ubon, Thailand. Also, to avoid duplication, this letter will dif- ferentiate segregating generations planted in d ifferent locations (for example, IRRI farm and Ajuy, Iloilo). Generations after the location code are selected from that location unless another code is encountered. Letter codes that desig- nate breeding methods other than plant selection are as follows: -B for bulk, -R for rapid generation advance or single seed descent, and -AC for anther culture. 4. Mapping populations will receive an IR cross designation from the database administrator of PBGB. Fixed lines from a mapping population can be assigned a shorter designation using the IR cross number followed by the plant number and ‘MP’ (e.g. IR72746-1 MP, -2 MP, etc.) Designation of IRRI fi xed lines 1. Fixed lines are those that have reached uniformity and are harvested in bulk from an advanced generation row (or are the F1 cross of two fi xed lines, in the case of hybrid rice). These lines are usually entered into observational or yield trials. Fixed lines receive a shortened “IR” designation with the following for- mat: IRYYX### where • ‘YY’ is the year the line was bulk-harvested for advanced evaluation • ‘X’ is a letter designation representing the source breeding program (see Table 1) • ‘###’ is a serial number assigned by the developer, usually beginning with 101 • Example: IR05U121 is an upland line (no. 121) bulk-harvested in 2005 40 June 2006 Table 1. Letters assigned to each breeding 2. For hybrid rice, the letter codes will con- program/ecosystem. tinue to be placed after the line designation: Letter Ecosystem H for the hybrid, R for the restorer lines, A N, A, M Irrigated rice for the CMS line, B for the maintainer line, N= NPT and S for a TGMS or PGMS parent. A= Indica favorable lowland M= Micronutrients Examples: L Rainfed lowland and aerobic rice • IR06H101 is a fi xed breeding line T Salinity developed in the hybrid breeding program. U Upland K KSMP and GUVA • IR06H105H is an F1 hybrid. W Wide hybridization • IR06N232A is an A line derived from the H Hybrid irrigated breeding program (N). The F Anaerobic/submergence J JIRCAS-IRRI collaboration corresponding B line would be IR06N232B. G GML • IR06H203S is a TGMS line. E Africa 3. The database administrator of PBGB will coordinate the designation of fi xed lines to avoid any duplication. Designation of IRRI elite lines 1. IRRI elite lines are those that combine multiple superior characteristics such as high yield, good eating quality, and resistance to insects, diseases, or abiotic stresses. IRRI-developed germplasm released as cultivars by national programs or germplasm that performed well in at least 2 years of multilocation yield trials can be designated as IRRI elite lines. The initial set of elite lines includes the varieties released in national programs. The IRRI elite lines will be given a three-digit number that follows the name “IRRI”, beginning with IRRI 101 (see Table 2). 2. Future decisions on naming IRRI elite lines will be made by the Standing Committee on Naming Elite Germplasm. The committee will follow a two- track system for naming elite lines. Those lines released as cultivars in the Philippines or another country will be named upon submission of a summary of the performance in the national testing program. Those not released by a national program will be considered on an annual basis upon submission of appropriate data (at least 2 years of multilocation trials and supporting screen- ing data). 3. IRRI scientists using fi xed or elite lines from the IRRI breeding program should use the new names as the primary designation for these lines and can use other popular names as an additional descriptor when needed. For example: “IRRI 105 (PSBRc 18)”; “IRRI 132 (Apo)”, etc. 4. For distribution of seed from IRRI, scientists should use the IRRI name in pref- erence to any local names. However, national programs are allowed and en- couraged to rename IRRI lines in a manner compatible with their own n aming system, as long as the source of the material is acknowledged. 5. For IRRI scientists c onducting fi eld experiments using a v ariety released in that c ountry, the country name can be used as the fi rst designation, with the IRRI name following in parentheses, for fi eld signs or reports. IRRN 31.1 41 Table 2. IRRI elite lines. Elite name Designation Cross Released name (Philippines) IR5 IR5-47 PETA/TANGKAI ROTAN IR8 IR8-288 PETA/DEE GEO WOO GEN IR20 IR532-E576 IR262-24-3/TKM 6 IR22 IR579-160-2 IR8/TADUKAN IR24 IR661-1-140 IR8/IR 127-2-2 IR26 IR1541-102 IR24/TKM 6 IR28 IR2061-214-3-8 IR833-6-2-1-1//IR 1561-149-1/IR 1737 IR29 IR2061-464-4-14 IR833-6-2-1-1//IR 1561-149-1/IR 1737 IR30 IR2153-159-1 IR24/TKM 6//IR 20*4/O NIVARA IR32 IR2070-747-6-3 IR20*2/O NIVARA//CR 94-13 IR34 IR2061-213-2 IR833-6-2-1-1//IR 1561-149-1/IR 1737 IR36 IR2071-625-1 IR1561-228-1-2/IR 1737//CR 94-13 IR38 IR2070-423-2-5 IR20*2/O NIVARA//CR 94-13 IR40 IR2070-414-3 IR20*2/O NIVARA//CR 94-13 IR42 IR2071-586-5-6 IR1561-228-1-2/IR 1737//CR 94-13 IR43 IR1529-430-3 IR305-3-17-1-3/IR 24 IR44 IR2863-38-1 IR1529-680-3/CR 94-13//IR 480-5-9-3 IR45 IR2035-242 IR1416-128-5/IR 1364-37-3-1//IR 1824-1 IR46 IR2058-78-1-3 IR1416-131-5/IR 1364-37-3-1//IR 1366-120-3-1/IR 1539-111 IR48 IR4570-83-3-3 IR1702-74-3-2/IR 1721-11-6-8-3-2//IR 2055-481-2 IR50 IR9224-117-2-3-3 IR2153-14-1-6-2/IR 28//IR 36 IR52 IR5853-118 NAM SA GUI 19/IR 2071-88//IR 2061-214-3-6-20 IR54 IR5853-162-1-2 NAM SA GUI 19/IR 2071-88//IR 2061-214-3-6-20 IR56 IR13429-109-2-2 IR4432-53-33/PTB 33//IR 36 IR58 IR9752-71-3 IR28/KWANG CHANG AI//IR 36 IR60 IR13429-299-2-1 IR4432-53-33/PTB 33//IR 36 ARIKARAI///IR 24/TKM 6//IR 20*4/O NIVARA/4/IR 1561-228-1-2/IR IR62 IR13525-43-2-3-1-3 1737//CR 94-13 IR64 IR18348-36-3 IR5657-33-2-1/IR 2061-465-1-5-5 IR65 IR21015-196-3-1 BATATAIS/IR 36//IR 52 IR66 IR32307-107-3-2 IR13240-108-2-2-3/IR 9129-209-2-2-2-1 IR68 IR28224-3-2-3 IR19660-73-4/IR 2415-90-4-3-2//IR 54 IR70 IR28228-12-3-1-1 IR19660-73-4/IR 54//IR 9828-36-3 IR72 IR35366-90-3-2-1 IR19661-9-2-3-3/IR 15795-199-3-3//IR 9129-209-2-2-2-1 IR74 IR32453-20-3-2 IR19661-131-1-2/IR 15795-199-3-3 IRRI 101 IR10147-113-5-1-1-5 KN-1B-361-1-8-6/IR 1750-F5 B-3//BPI 76*9/DAWN PSBRc 1 IRRI 102 IR32809-26-3-3 IR4215-301-2-2-6/BG 90-2//IR 19661-131-1-2 PSBRc 2 IRRI 103 IR41985-111-3-2-2 IR4547-4-1-2/IR 1905-81-3-1//IR 25621-94-3-2 PSBRc 4 IRRI 104 IR50404-57-2-2-3 IR33021-39-2-2/IR 32429-47-3-2-2 PSBRc 10 IRRI 105 IR51672-62-2-1-1-2-3 IR24594-204-1-3-2-6-2/IR 28222-9-2-2-2-2 PSBRc 18 IRRI 106 IR57301-195-3-3 IR35293-125-3-2-3/IR 32429-47-3-2-2//IR 41985-111-3-2-2 PSBRc 20 IRRI 107 IR64616 H IR62829 A/IR 29723-143-3-2-1R PSBRc 26 H IRRI 108 IR56381-139-2-2 IR28239-94-2-3-6-2/IR 64 PSBRc 28 IRRI 109 IR58099-41-2-3 IR72/IR 24632-34-2 PSBRc 30 IRRI 110 IR59469-B-B-3-2 IR9202-5-2-2-2//KN-1B-361-1-8-6/IR 15889-32-1 PSBRc 44 IRRI 111 IR25976-12-2-2-2-1-1 JUMALI/IR 9129-159-3//KN-1B-361-1-8-6-9 PSBRc 46 IRRI 112 IR9884-54-3-1 NONA BOKRA/IR 2070-414-3-9-6//IR 34 PSBRc 48 IRRI 113 IR51500-AC 11-1 IR5657-33-2/IR 4630-22-2-5-1-3 PSBRc 50 IRRI 114 IR47686-30-3-2 IRAT 104/PALAWAN PSBRc 5 IRRI 115 IR59682-132-1-1-2 IR48613-54-3-3-1/IR 28239-94-2-3-6-2 PSBRc 52 IRRI 116 IR60819-34-2-1 IR72/IR 48525-100-1-2 PSBRc 54 IRRI 117 IR41431-68-1-2-3 IR8234-OT-9-2/IR 19661-131-1-2 PSBRc 60 IRRI 118 IR59552-21-3-2-2 PSBRC 2/IR 39292-142-3-2-3 PSBRc 64 IRRI 119 IR57515-PMI 8-1-1-SRN 1-1 IR43581-57-3-3-6/IR 26940-20-3-3-3-1//KHAO DAWK MALI 105 PSBRc 68 IRRI 120 IR60267-11-2-2-1 RD 15/IR 43485-22-2-2-2//IR 68 PSBRc 70 IRRI 121 IR68284 H IR58025 A/IR 34686-179-1-2-1 R PSBRc 72 H IRRI 122 IR62141-114-3-2-2-2 IR50401-77-2-1-3/IR 42068-22-3-3-1-3 PSBRc 80 IRRI 123 IR64683-87-2-2-3-3 IR47761-27-1-3-6/PSB RC 28 PSBRc 82 IRRI 124 IR65185-3B-8-3-2 CSR 10/TCCP 266-B-B-B-10-3-1 PSBRc 84 IRRI 125 IR65195-3B-13-2-3 IR10198-66-2/TCCP 266-B-B-B-10-3-1 PSBRc 86 IRRI 126 IR52713-2B-8-2B-1-2 IR64//IR 4630-22-2-5-1-3/IR 9764-45-2-2 PSBRc 88 IRRI 127 IR69726-29-1-2-2-2 IR52256-84-2-3/IR 72//IR 1561-228-3*2/UTRI MERAH MATATAG 2 IRRI 128 IR61920-3B-22-2-1 IR32429-47-3-2/WAGWAG NSIC Rc 106 IRRI 129 IR9202-25-1-3 IR2053-521-1-1-1/K 116//KN-1B-361-1-8-6-9-1 PSBRc 92 IRRI 130 IR61336-4B-14-3-2 IR44535-22-3-3-3/IR 8866-30-3-1-4-2 PSBRc 94 IRRI 131 IR61608-3B-20-2-2-1-1 IR32429-47-3-2-2//DOBONGBYEO/MOROBEREKAN PSBRc 96 IRRI 132 IR55423-1 UPL RI 5/IR 12979-24-1 (BROWN) NSIC Rc 9 IRRI 133 IR54068-B-60-1-3-3 DHULA/IR 28878-R-R-27-3-1//IR 31802-48-2-2-2 PSBRc 102 IRRI 134 IR73885-1-4-3-2-1-6 IR64*2/O RUFIPOGON (IRGC 105908) MATATAG 9 IRRI 135 IR71606-1-1-4-2-3-1-2 IR1561*3/HABIGANJ DW 8//5*IR 64 NSIC Rc 110 IRRI 136 IR72102-4-159-1-3-3-3 IR1561*2/O BARTHII//4*IR 64 NSIC Rc 112 IRRI 137 IR75207 H IR68888 A/IR 62161-184-3-1-3-2 R NSIC Rc 114 H IRRI 138 IR75217 H IR68897 A/IR 60819-34-2 R NSIC Rc 116 H IRRI 139 IR68144-2B-2-2-3 IR72/ZAWA BONDAY MS 13 IRRI 140 IR68305-18-1-1 BALIMAU PUTIH/4*IR 64 NSIC Rc 118 IRRI 141 IR61979-138-1-3-2-3 IR44625-139-2-2-3/IR 32822-94-3-3-2-2 NSIC Rc 122 IRRI 142 IR68333-R-R-B-22 JINMIBYEO/CHEOLWEON 46 MS 11 42 June 2006 Published quarterly, Outlook on Agriculture addresses an international and interdisciplinary readership. Each issue includes refereed papers, opinion pieces and commentary on recent scientific, political and economic developments. Special attention is paid to: • food policy and strategic developments in food production; • the role of agriculture in social and economic development; • agriculture and human health; and • environmental impacts and strategies. Subscribing institutions include universities, government departments, international organizations, consultancies, and scientific and technical departments in major industrial companies. Submissions: The editor welcomes submissions to Outlook on Agriculture. Notes for authors are available on the IP Website (www.ippublishing.com). Articles should be double-spaced, printed on one side of the paper and sent in triplicate, with a disk specifying the software used. Papers are refereed before publication. Please send submissions to: Dr David Lister, c/o IP Publishing Ltd, Coleridge House, 4–5 Coleridge Gardens, London NW6 3QH, UK. Dr Lister may also be contacted directly at outlookonagric@dsl.pipex.com or on tel/fax +44 193 484 4163. To subscribe or to request a free sample copy, contact: IP Publishing Ltd, Turpin Distribution Ltd, Stratton Business Park, Pegasus Drive, Biggleswade, Bedfordshire SG18 8TQ, UK. Tel: +44 1767 604957. Fax: +44 1767 601640. E-mail: subscriptions@turpin-distribution.com. Subscription prices for the 2006 volume (four issues): USA – $367.00; Euro Zone – !360.00; Rest of World – £238.00. INSTRUCTIONS TO CONTRIBUTORS IRRN welcomes three types of submitted be supplied. Restrain acknowledgments. mention, followed by the acronym or manuscripts: research notes, mini reviews, Limit each note to no more than two abbreviation in parentheses. Use the and “notes from the fi eld.” All manuscripts pages of double-spaced type-written text abbreviation thereafter. must have international or pan-national (approximately 500 words). • Defi ne any nonstandard abbreviation relevance to rice science or production, Each note may include up to two or symbol used in tables or fi gures in be written in English, and be an original tables and/or fi gures (graphs, illustrations, a footnote, caption, or legend. work of the author(s), and must not have or photos). Refer to all tables and fi gures been previously published elsewhere. By in the text. Group tables and fi gures at the Mini reviews submitting the manuscript, the author end of the note, each on a separate page. Mini reviews should address topics of automatically assigns the copyright of the Tables and fi gures must have clear titles current interest to a broad selection of rice article to IRRI. that adequately explain contents. researchers, and highlight new develop- Apply these rules, as appropriate, to ments that are shaping current work in Research notes all research notes: the fi eld. Authors should contact the ap- Research notes submitted to IRRN propriate editorial board member before should Methodology submitting a mini review to verify that the • report on work conducted during • Include an internationally known subject is appropriate and that no similar the immediate past 3 yr or work in check or control treatment in all reviews are already in preparation. (A list progress experiments. of the editors and their areas of respon- • advance rice knowledge • Report grain yield at 14% mois- sibility appears on the inside front cover • use appropriate research design and ture content. of each IRRN issue.) Because only 1-2 data collection methodology • Quantify survey data, such as in mini reviews can be published per issue, • report pertinent, adequate data fection percentage, degree of IRRN will require high quality standards • apply appropriate statistical analysis, severity, and sampling base. for manuscripts accepted for publication. and • When evaluating susceptibility, The reviews should be 2000-3000 words • reach supportable conclusions. resistance, and tolerance, report the long, including references. Refer to the Routine research. Reports of actual quantifi cation of guidelines for research notes for other screening trials of varieties, fertilizer, damage due to stress, which was aspects of writing and content. cropping methods, and other routine ob- used to assess level or incidence. servations using standard methodologies Specify the measurements used. Notes from the fi eld to establish local recommendations are not • Provide the genet ic background Notes from the fi eld should address im- ordinarily accepted. for new varieties or breeding portant new observations or trends in rice- Preliminary research fi ndings. To lines. growing areas, such as pest outbreaks or reach well-supported conclusions, fi eld • Specify the rice production sys new pest introductions, or the adoption or trials should be repeated across more than tems as irrigated, rainfed lowland, spread of new crop management practices. one season, in multiple seasons, or in more upland, and fl ood-prone (deepwater These observations, while not the result of than one location as appropriate. Prelimi- and tidal wetlands). experiments, must be carefully described nary research fi ndings from a single season • Indicate the type of rice culture and documented. Notes should be ap- or location may be accepted for publication (transplanted, wet seeded, dryseed- proximately 250 words in length. Refer to in IRRN if the fi ndings are of exceptional ed). the guidelines for research notes for other interest. aspects of writing and content. Prel iminary data published in IRRN Terminology may later be published as part of a more • If local terms for seasons are used, Review of manuscripts extensive study in another peer-reviewed defi ne them by characteristic weather The IRRN managing editor will send an publication, if the original IRRN article is (dry season, wet season, monsoon) and acknowledgment card or an email message cited. However, a note submitted to IRRN by months. when a note is received. An IRRI scientist, should not consist solely of data that have • Use standard, internationally recog- selected by the editorial board, reviews been extracted from a larger publication nized terms to describe rice plant each note. Depending on the reviewer’s that has already been or will soon be pub- parts, growth stages, and management report, a note will be accepted for publica- lished elsewhere. practices. Do not use local names. tion, rejected, or returned to the author(s) Multiple submissions. Normally, • Provide scientifi c names for diseases, for revision. only one report for a single experiment insects, weeds, and crop plants. Do not will be accepted. Two or more items about use local names alone. Submission of manuscripts the same work submitted at the same time • Do not use local monetary units. Submit the original manuscript and a du- will be returned for merging. Submitting Express all economic data in terms of plicate, each with a clear copy of all tables at different times multiple notes from the the US$, and include the exchange rate and fi gures, to IRRN. Retain a copy of the same experiment is highly inappropriate. used. note and of all tables and fi gures. Detection will result in the rejection of all • Use generic names, not trade names, Send manuscripts, correspondence, submissions on that research. for all chemicals. and comments or suggestions about IRRN Manuscript preparation. Arrange • Use the International System of Units by mail or email to the note as a brief statement of research for all measurements. For example, objectives, a short description of project express yield data in metric tons per The IRRN Managing Editor design, and a succinct discussion of results. hectare (t ha-1) for fi eld studies. Do not IRRI, DAPO Box 7777 Relate results to the objectives. Do not use local units of measure. Metro Manila, Philippines include abstracts. Up to fi ve references • When using acronyms or abbrevia- Fax: +63 (2) 580-5699; 891-1174 may be cited. A list of 3-5 key words should tions, write the name in full on fi rst E-mail: t.rola@cgiar.org 44 June 2006 IRRN 31.1 45 46 June 2006 Join the harvest Call for entries IRRN Best Article Awards To celebrate its 30th year, the International Rice Research Notes (IRRN) is now accepting entries for the 2006 IRRN Best Article Award. The Best Article Award reaps the contributions of rice researchers from national agricultural research and extension systems (NARES) in developing countries toward the advancement and exchange of rice-related knowledge and technology. There will be six winning papers from the six sections of IRRN: plant breeding (includes papers on molecular biology and biotechnology); genetic resources; pest science and management; soil, nutrient, and water management/en- vironment; crop management and physiology; and socioeconomics/agricultural engineering. Mechanics of the Best Article Award: • Competition is open to all NARES rice researchers. • Research must have been conducted in a developing country. • Manuscripts that have been accepted from 1 August 2005 to 30 June 2006 will be evaluated for the award. For details, • Authors who are requested to revise their manuscripts must send the fi nal contact the version within three weeks after the receipt of the reviewer’s comments. IRRN Managing • The deadline for submission of articles is on 30 June 2006. Editor, IRRI, • Winners will be chosen by the IRRN Editorial Board and invited reviewers. The winning entries DAPO Box 7777 Metro will be selected on the basis of scientifi c content, originality, relevance, and organization. Manila, Philippines • The Award will be given to the fi rst author of each paper. Additional authors may come from any Fax: +63 (2) 580-5699; 891-1174 organization. E-mail: t.rola@cgiar.org • Each winner will receive a plaque and a US$500 cash prize. • The awarding ceremony will be held during the International Rice Research Conference in India in October 2006. • The winning entries will be announced in the October 2006 of Rice Today and the winning articles will be published in the December 2006 issue of IRRN. The International Rice Research Notes (IRRN) To learn more about IRRI, visit our Web site (www. How to subscribe to IRRN. Individuals who work is published by the International Rice Research irri.org). IRRN is also available online (www.irri. in the fi eld of rice research are qualifi ed to receive Institute (IRRI) to help scientists keep one another org/irrn). FREE subscriptions. To subscribe and receive Vol. informed of current rice research fi ndings. The How to contribute a manuscript. IRRN welcomes 31.1/2006 by August 2006, please fi ll in the enclosed concise scientifi c notes are meant to encourage three types of submitted manuscripts: research order form and send to us by e-mail (irripub@cgiar. rice scientists to communicate with one another to notes, mini reviews, and “notes from the fi eld.” All org), fax (+632-5805699, +632-8911292) or post obtain details on the research reported. manuscripts must have international or pan-national (DAPO Box 7777, Metro Manila, Philippines)] by Hundreds of research notes, reviews and relevance to rice science or production, be written May 31. “notes from the fi eld” related to rice science and in English, and be an original work of the author(s), Invite a colleague to the IRRN Community. production have appeared in IRRN. Published twice and must not have been previously published else- Would a fellow researcher or scientist be interested each year, it serves as the medium of communication where. Send manuscripts, correspondence, and in contributing or subscribing to IRRN? Please send exchange among scientists and keeps them abreast comments or suggestions about IRRN by mail or us his or her contact information by May 31, 2006, with developments in rice technology and rice-based email to t.rola@cgiar.org. and we will be happy to send your referral a com- cropping systems. plimentary copy. IRRN 30.1 49 Science, technology, and trade for peace and prosperity International Rice Congress 2006 Bringing together the international rice community to address emerging issues for the world’s most important crop 9-13 October 26th International Rice Research Conference Innovations for effi ciency enhancement 10-11 October 2nd International Rice Commerce Conference Product diversifi cation, value addition, and business promotion 10-13 October 2nd International Rice Technology and Cultural Exhibition Rice culture in agriculture 9-10 October 2nd International Ministerial Round Table Meeting Fostering partnerships in rice research, development, and trade International Rice Congress 2006 is jointly organized by the Government of India (Ministry of Agriculture, Food Technology, and Cooperation through the Department of Agricultural Research and Education and Indian Council of Agricultural Research [ICAR]) and the International Rice Research Institute (IRRI). For more information: www.icar.org.in/irc2006 E-mail: rice2006@gmail.com Pramod K. Aggarwal Organizing Secretary of the IRC 2006 Fax: 91-11-2584-1866 Jagdish K. Ladha IRRI-India offi ce Fax: 91-11-2584-1801 Duncan Macintosh International Rice Research Institute Fax: 63-2-845-0606 E-mail: d.macintosh@cgiar.org The premier international event for the food that feeds almost half the planet DAPO Box 7777, Metro Manila, Philippines Printed matter